EMAIL THIS PAGE TO A FRIEND

HK1

hexokinase 1

133 Gene Product Result for
Synonyms: HK1-ta HK1-tb HK1-tc HKD HKI HMSNR HXK1
Gene ID:
Human(3098) Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in five transcript variants which encode different isoforms, some of which are tissue-specific. Each isoform has a distinct N-terminus; the remainder of the protein is identical among all the isoforms. A sixth transcript variant has been described, but due to the presence of several stop codons, it is not thought to encode a protein. [provided by RefSeq, Apr 2009]
Mouse(15275) hexokinase 1
Rat(25058) hexokinase 1
Zebrafish(406791) hexokinase 1
cow(280817) hexokinase 1
Horse(100072687) hexokinase 1
dog(479234) hexokinase 1
chicken(373889) hexokinase 1
Thale Cress(816291) histidine kinase 1
sheep(100036759) hexokinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H2665 Anti-HK1 (416-430) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
H2790 Anti-HK1 (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1409191 Anti-HK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2701748 Anti-hk1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA007044 Anti-HK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA011956 Anti-HK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA007043 Anti-HK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB1410630 Anti-HK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, rat
immunoprecipitation (IP), western blot pricing
SAB4501394 Anti-HXK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0003098M1 Monoclonal Anti-HK1 antibody produced in mouse clone 5G9, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300279 Monoclonal Anti-HK1 antibody produced in mouse clone 7A7, ascites fluid mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300280 Monoclonal Anti-HK1 antibody produced in mouse clone 3A10, ascites fluid mouse, human, rat
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK091 Hexokinase Colorimetric Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000188 Rosetta Predictions human pricing
NM_033496 Rosetta Predictions human pricing
NM_033497 Rosetta Predictions human pricing
NM_033498 Rosetta Predictions human pricing
NM_033500 Rosetta Predictions human pricing
NM_012734 Rosetta Predictions rat pricing
NM_010438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226390 predicted 1360
2 SASI_Hs02_00302036 predicted 2357
3 SASI_Hs01_00226392 predicted 1994
4 SASI_Hs01_00226394 predicted 1112
5 SASI_Hs01_00226395 predicted 1768
6 SASI_Hs02_00302037 predicted 2539
7 SASI_Hs01_00226396 predicted 701
8 SASI_Hs01_00226398 predicted 746
9 SASI_Hs02_00302038 predicted 2120
10 SASI_Hs02_00302039 predicted 2442
11 SASI_Hs01_00226391 predicted 1502
12 SASI_Hs01_00226393 predicted 868
13 SASI_Hs01_00226397 predicted 1075
14 SASI_Hs01_00226399 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114586 predicted 1359
2 SASI_Hs02_00361355 predicted 2354
3 SASI_Hs01_00114588 predicted 1989
4 SASI_Hs01_00114590 predicted 1104
5 SASI_Hs01_00114591 predicted 1771
6 SASI_Hs02_00361356 predicted 2531
7 SASI_Hs01_00114592 predicted 695
8 SASI_Hs01_00114594 predicted 745
9 SASI_Hs02_00361357 predicted 2119
10 SASI_Hs02_00361358 predicted 2447
11 SASI_Hs01_00114587 predicted 1563
12 SASI_Hs01_00114589 predicted 925
13 SASI_Hs01_00114593 predicted 1137
14 SASI_Hs01_00114595 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047480 predicted 1573
2 SASI_Hs02_00361359 predicted 2576
3 SASI_Hs01_00047482 predicted 2206
4 SASI_Hs01_00047484 predicted 1326
5 SASI_Hs01_00047485 predicted 1984
6 SASI_Hs02_00361360 predicted 2752
7 SASI_Hs01_00047486 predicted 921
8 SASI_Hs01_00047488 predicted 962
9 SASI_Hs02_00361361 predicted 2332
10 SASI_Hs02_00361362 predicted 2660
11 SASI_Hs01_00047481 predicted 1737
12 SASI_Hs01_00047483 predicted 1103
13 SASI_Hs01_00047487 predicted 1312
14 SASI_Hs01_00047489 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186797 predicted 1623
2 SASI_Hs02_00361363 predicted 2627
3 SASI_Hs01_00186799 predicted 2258
4 SASI_Hs01_00186801 predicted 1373
5 SASI_Hs01_00186802 predicted 2039
6 SASI_Hs02_00361364 predicted 2807
7 SASI_Hs01_00186803 predicted 974
8 SASI_Hs01_00186805 predicted 1021
9 SASI_Hs02_00361365 predicted 2390
10 SASI_Hs02_00361366 predicted 2712
11 SASI_Hs01_00186798 predicted 1797
12 SASI_Hs01_00186800 predicted 1163
13 SASI_Hs01_00186804 predicted 1366
14 SASI_Hs01_00186806 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065260 predicted 1722
2 SASI_Hs02_00361367 predicted 2718
3 SASI_Hs01_00065262 predicted 2347
4 SASI_Hs01_00065264 predicted 1472
5 SASI_Hs01_00065265 predicted 2128
6 SASI_Hs02_00361368 predicted 2902
7 SASI_Hs01_00065266 predicted 1065
8 SASI_Hs01_00065268 predicted 1111
9 SASI_Hs02_00361369 predicted 2482
10 SASI_Hs02_00361370 predicted 2804
11 SASI_Hs01_00065261 predicted 1884
12 SASI_Hs01_00065263 predicted 1250
13 SASI_Hs01_00065267 predicted 1455
14 SASI_Hs01_00065269 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100013 predicted 1122
2 SASI_Rn01_00100014 predicted 2692
3 SASI_Rn01_00100015 predicted 2410
4 SASI_Rn01_00100018 predicted 2352
5 SASI_Rn01_00100019 predicted 2261
6 SASI_Rn01_00100020 predicted 570
7 SASI_Rn02_00260080 predicted 2228
8 SASI_Rn01_00100021 predicted 2448
9 SASI_Rn02_00260081 predicted 1740
10 SASI_Rn02_00260082 predicted 2065
11 SASI_Rn01_00100016 predicted 2740
12 SASI_Rn01_00100017 predicted 915
13 SASI_Rn01_00100022 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022875 predicted 1294
2 SASI_Mm01_00022876 predicted 2578
3 SASI_Mm01_00022877 predicted 2522
4 SASI_Mm01_00022878 predicted 1293
5 SASI_Mm01_00022879 predicted 1140
6 SASI_Mm01_00022880 predicted 2450
7 SASI_Mm01_00022881 predicted 1296
8 SASI_Mm01_00022882 predicted 1523
9 SASI_Mm01_00022883 predicted 2513
10 SASI_Mm01_00022884 predicted 2438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033498
VALIDATED
HK1 MISSION shRNA Bacterial Glycerol Stock
hexokinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-2382s1c1
Sequence:CCGGCCTGTGAGGTTGGACTCATTGCTCGAGCAATGAGTCCAACCTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1168s1c1
Sequence:CCGGCGATGGATCATTAGAAGACATCTCGAGATGTCTTCTAATGATCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3342s1c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1879s1c1
Sequence:CCGGGCACAACAATGCCGTGGTTAACTCGAGTTAACCACGGCATTGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3291s1c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-465s1c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2632s1c1
Sequence:CCGGCCGCAACATCTTAATCGACTTCTCGAGAAGTCGATTAAGATGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-1413s1c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-769s1c1
Sequence:CCGGCCTGGGAGATTTCATGGAGAACTCGAGTTCTCCATGAAATCTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2050s1c1
Sequence:CCGGCGCCATTCCTATTGAAATCATCTCGAGATGATTTCAATAGGAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3342s21c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-1413s21c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-465s21c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3291s21c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033498
VALIDATED
HK1 MISSION shRNA shRNA Plasmid DNA
hexokinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-2382s1c1
Sequence:CCGGCCTGTGAGGTTGGACTCATTGCTCGAGCAATGAGTCCAACCTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1168s1c1
Sequence:CCGGCGATGGATCATTAGAAGACATCTCGAGATGTCTTCTAATGATCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3342s1c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1879s1c1
Sequence:CCGGGCACAACAATGCCGTGGTTAACTCGAGTTAACCACGGCATTGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3291s1c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-465s1c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2632s1c1
Sequence:CCGGCCGCAACATCTTAATCGACTTCTCGAGAAGTCGATTAAGATGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-1413s1c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-769s1c1
Sequence:CCGGCCTGGGAGATTTCATGGAGAACTCGAGTTCTCCATGAAATCTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2050s1c1
Sequence:CCGGCGCCATTCCTATTGAAATCATCTCGAGATGATTTCAATAGGAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3342s21c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-1413s21c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-465s21c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3291s21c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033498
VALIDATED
HK1 MISSION shRNA Lentiviral Transduction Particles
hexokinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-2382s1c1
Sequence:CCGGCCTGTGAGGTTGGACTCATTGCTCGAGCAATGAGTCCAACCTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1168s1c1
Sequence:CCGGCGATGGATCATTAGAAGACATCTCGAGATGTCTTCTAATGATCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3342s1c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-1879s1c1
Sequence:CCGGGCACAACAATGCCGTGGTTAACTCGAGTTAACCACGGCATTGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033498.1-3291s1c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-465s1c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2632s1c1
Sequence:CCGGCCGCAACATCTTAATCGACTTCTCGAGAAGTCGATTAAGATGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-1413s1c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033498.1-769s1c1
Sequence:CCGGCCTGGGAGATTTCATGGAGAACTCGAGTTCTCCATGAAATCTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033498.1-2050s1c1
Sequence:CCGGCGCCATTCCTATTGAAATCATCTCGAGATGATTTCAATAGGAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3342s21c1
Sequence:CCGGCCACTTTGCATGGTTTGATTTCTCGAGAAATCAAACCATGCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-1413s21c1
Sequence:CCGGGCCTCCACAATGCCAAAGAAACTCGAGTTTCTTTGGCATTGTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033498.2-465s21c1
Sequence:CCGGCCGATGAAACTCTCATAGATACTCGAGTATCTATGAGAGTTTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033498.2-3291s21c1
Sequence:CCGGGCGTGTGCTGTTGATAATATCCTCGAGGATATTATCAACAGCACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010438
VALIDATED
HK1 MISSION shRNA Bacterial Glycerol Stock
hexokinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-760s1c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2869s1c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2539s1c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2095s1c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-1501s1c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2091s21c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2535s21c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-1497s21c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2865s21c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-756s21c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010438
VALIDATED
HK1 MISSION shRNA shRNA Plasmid DNA
hexokinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-760s1c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2869s1c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2539s1c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2095s1c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-1501s1c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2091s21c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2535s21c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-1497s21c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2865s21c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-756s21c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010438
VALIDATED
HK1 MISSION shRNA Lentiviral Transduction Particles
hexokinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-760s1c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2869s1c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2539s1c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-2095s1c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010438.1-1501s1c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2091s21c1
Sequence:CCGGGAGCCTAGATTGCGGAATCTTCTCGAGAAGATTCCGCAATCTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2535s21c1
Sequence:CCGGCCTGATTGACTTCACCAAGAACTCGAGTTCTTGGTGAAGTCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-1497s21c1
Sequence:CCGGCGTAGACGGTTCTCTCTACAACTCGAGTTGTAGAGAGAACCGTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-2865s21c1
Sequence:CCGGCCATCCACACTTCTCCAGAATCTCGAGATTCTGGAGAAGTGTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010438.2-756s21c1
Sequence:CCGGGCTGCTGAATAAAGCCATTAACTCGAGTTAATGGCTTTATTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)