HK2

hexokinase 2

55 Gene Product Result for

Synonyms: HKII HXK2

Species: Human HK2(3099), Mouse Hk2(15277), Rat Hk2(25059), domestic guinea pig Hk2(100732658), naked mole-rat Hk2(101722401), sheep HK2(101107690), Domestic Rabbit HK2(100338214), Zebrafish hk2(406339), Thale Cress HK2(833552), chicken HK2(374044), domestic cat HK2(101089344), cow HK2(788926), Horse HK2(100009677), dog HK2(475781)

UniProtKB ID: P52789, D6W5J2, Q8WU87, Q9UN82

Gene ID:

Human(3099) Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]

Mouse(15277) hexokinase 2

Rat(25059) hexokinase 2

domestic guinea pig(100732658) hexokinase 2

naked mole-rat(101722401) hexokinase 2

sheep(101107690) hexokinase 2

Domestic Rabbit(100338214) hexokinase 2

Zebrafish(406339) hexokinase 2

Thale Cress(833552) histidine kinase 2

chicken(374044) hexokinase 2

domestic cat(101089344) hexokinase 2

cow(788926) hexokinase 2

Horse(100009677) hexokinase 2

dog(475781) hexokinase 2

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB5700666	Anti-Hexokinase II antibody produced in rabbit	human, rat, mouse	immunofluorescence, immunohistochemistry, western blot	pricing

SAB2701698	Anti-hk2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	zebrafish	western blot	pricing

HPA028587	Anti-HK2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

SAB2108077	Anti-HK2 antibody produced in rabbit affinity isolated antibody	bovine, human, rabbit, mouse, rat, horse, dog, guinea pig	immunohistochemistry, western blot	pricing

SAB5300278	Monoclonal Anti-HK2 antibody produced in mouse clone 3D3, ascites fluid	human	ELISA, flow cytometry, immunohistochemistry, western blot	pricing

SAB1402221	Monoclonal Anti-HK2, (C-terminal) antibody produced in mouse clone 4H1, purified immunoglobulin, buffered aqueous solution	rat, human	ELISA, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST77897	PrEST Antigen HK2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST25037	SILu^™PrEST HXK2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST25038	SILu^™PrEST HXK2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

Kits

Product #	Description	Species	Add to Cart

MAK091	Hexokinase Colorimetric Assay Kit sufficient for 100 colorimetric tests	human, mouse, rat	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR11525	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, HK2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_013820	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_013820	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_013820	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_000189	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000189	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000189	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU903721	MISSION^® esiRNA targeting human HK2	human	pricing

EMU039591	MISSION^® esiRNA targeting mouse Hk2	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000189	Rosetta Predictions	human	pricing
NM_012735	Rosetta Predictions	rat	pricing
NM_013820	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000189	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00080105 predicted	4179
2	SASI_Hs01_00080106 predicted	2843
3	SASI_Hs01_00080107 predicted	4536
4	SASI_Hs01_00080108 predicted	2196
5	SASI_Hs01_00080109 predicted	4269
6	SASI_Hs01_00080110 predicted	2410
7	SASI_Hs01_00080111 predicted	3398
8	SASI_Hs01_00080112 predicted	4529
9	SASI_Hs01_00080113 predicted	2012
10	SASI_Hs02_00302040 predicted	4221
11	SASI_Hs01_00080104 predicted	4183

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_012735	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00037498 predicted	2213
2	SASI_Rn02_00260083 predicted	1199
3	SASI_Rn01_00037500 predicted	791
4	SASI_Rn01_00037501 predicted	2439
5	SASI_Rn01_00037502 predicted	2190
6	SASI_Rn01_00037503 predicted	2830
7	SASI_Rn01_00037505 predicted	835
8	SASI_Rn02_00260084 predicted	285
9	SASI_Rn02_00260085 predicted	334
10	SASI_Rn01_00037506 predicted	2110
11	SASI_Rn01_00037499 predicted	601
12	SASI_Rn01_00037504 predicted	1220
13	SASI_Rn01_00037507 predicted	1773

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_013820	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00172799 predicted	1474
2	SASI_Mm01_00172800 predicted	1071
3	SASI_Mm01_00172805 predicted	1491
4	SASI_Mm01_00172801 predicted	3110
5	SASI_Mm01_00172802 predicted	3076
6	SASI_Mm01_00172804 predicted	1893
7	SASI_Mm02_00322790 predicted	482
8	SASI_Mm01_00172806 predicted	565
9	SASI_Mm01_00172808 predicted	1154
10	SASI_Mm02_00322791 predicted	3220
11	SASI_Mm01_00172803 predicted	881
12	SASI_Mm01_00172807 predicted	1030

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_013820 VALIDATED	HK2 MISSION shRNA Bacterial Glycerol Stock hexokinase 2	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280175
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-3693s21c1
	Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-1926s21c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012543
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_013820.1-3537s1c1
	Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2431s21c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012544
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013820.1-2436s1c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012547
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-1931s1c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-882s1c1
	Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-2042s1c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280118
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2037s21c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_013820 VALIDATED	HK2 MISSION shRNA shRNA Plasmid DNA hexokinase 2	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280175
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-3693s21c1
	Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000280119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-1926s21c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000012543
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_013820.1-3537s1c1
	Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000280174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2431s21c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000012544
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013820.1-2436s1c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000012547
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-1931s1c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000012546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-882s1c1
	Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000012545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-2042s1c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000280118
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2037s21c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_013820 VALIDATED	HK2 MISSION shRNA Lentiviral Transduction Particles hexokinase 2	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280175
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-3693s21c1
	Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-1926s21c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012543
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_013820.1-3537s1c1
	Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2431s21c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012544
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013820.1-2436s1c1
	Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012547
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-1931s1c1
	Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-882s1c1
	Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_013820.1-2042s1c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280118
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_013820.3-2037s21c1
	Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000189 VALIDATED	HK2 MISSION shRNA Bacterial Glycerol Stock hexokinase 2	Human

18 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232924
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2207s21c1
	Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232925
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2516s21c1
	Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232928
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000189.4-5921s21c1
	Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195340
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-3336s1c1
	Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2933s1c1
	Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196260
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-6738s1c1
	Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196724
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2518s1c1
	Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000197099
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-1983s1c1
	Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199344
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4327s1c1
	Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232927
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4365s21c1
	Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4188s21c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195171
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2334s1c1
	Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4188s1c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037672
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-3937s1c1
	Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037671
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2749s1c1
	Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2297s1c1
	Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037669
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2324s1c1
	Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037673
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2346s1c1
	Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000189 VALIDATED	HK2 MISSION shRNA shRNA Plasmid DNA hexokinase 2	Human

18 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232924
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2207s21c1
	Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232925
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2516s21c1
	Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232928
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000189.4-5921s21c1
	Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195340
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-3336s1c1
	Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2933s1c1
	Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196260
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-6738s1c1
	Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196724
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2518s1c1
	Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000197099
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-1983s1c1
	Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199344
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4327s1c1
	Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232927
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4365s21c1
	Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4188s21c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195171
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2334s1c1
	Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4188s1c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037672
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-3937s1c1
	Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037671
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2749s1c1
	Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2297s1c1
	Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037669
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2324s1c1
	Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037673
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2346s1c1
	Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000189 VALIDATED	HK2 MISSION shRNA Lentiviral Transduction Particles hexokinase 2	Human

18 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232924
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2207s21c1
	Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232925
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-2516s21c1
	Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232928
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000189.4-5921s21c1
	Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195340
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-3336s1c1
	Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2933s1c1
	Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196260
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-6738s1c1
	Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196724
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2518s1c1
	Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000197099
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-1983s1c1
	Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199344
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4327s1c1
	Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232927
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4365s21c1
	Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000189.4-4188s21c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195171
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2334s1c1
	Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-4188s1c1
	Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037672
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-3937s1c1
	Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037671
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A3
	TRC Version: 1	Clone ID:NM_000189.4-2749s1c1
	Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2297s1c1
	Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037669
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2324s1c1
	Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037673
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000189.4-2346s1c1
	Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart