EMAIL THIS PAGE TO A FRIEND

HK3

hexokinase 3 (white cell)

70 Gene Product Result for
Synonyms: HKIII HXK3
UniProtKB ID: P52790, Q8N1E7
Gene ID:
Human(3101) Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Mouse(212032) hexokinase 3
Rat(25060) hexokinase 3 (white cell)
Thale Cress(839621) histidine kinase 3
domestic cat(101080358) hexokinase 3 (white cell)
cow(510616) hexokinase 3 (white cell)
Horse(100068725) hexokinase 3 (white cell)
dog(489096) hexokinase 3 (white cell)
chicken(768421) hexokinase 3 (white cell)
sheep(101119209) hexokinase 3 (white cell)
Domestic Rabbit(100340994) hexokinase 3 (white cell)
domestic guinea pig(100725134) hexokinase 3 (white cell)
naked mole-rat(101706410) hexokinase 3 (white cell)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK091 Hexokinase Colorimetric Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002115 Rosetta Predictions human pricing
NM_022179 Rosetta Predictions rat pricing
NM_001033245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169443 predicted 1777
2 SASI_Hs01_00169444 predicted 2415
3 SASI_Hs01_00169445 predicted 1415
4 SASI_Hs01_00169446 predicted 1159
5 SASI_Hs01_00169447 predicted 976
6 SASI_Hs01_00169448 predicted 776
7 SASI_Hs01_00169450 predicted 2113
8 SASI_Hs01_00169451 predicted 538
9 SASI_Hs02_00333238 predicted 2596
10 SASI_Hs01_00169452 predicted 1537
11 SASI_Hs01_00169449 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109264 predicted 813
2 SASI_Rn01_00109265 predicted 381
3 SASI_Rn01_00109267 predicted 780
4 SASI_Rn01_00109268 predicted 1777
5 SASI_Rn01_00109269 predicted 2374
6 SASI_Rn02_00262924 predicted 1000
7 SASI_Rn01_00109270 predicted 1387
8 SASI_Rn01_00109271 predicted 2374
9 SASI_Rn01_00109272 predicted 447
10 SASI_Rn01_00109273 predicted 1068
11 SASI_Rn01_00109266 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096377 predicted 569
2 SASI_Mm01_00096378 predicted 801
3 SASI_Mm01_00096379 predicted 2246
4 SASI_Mm01_00096380 predicted 642
5 SASI_Mm01_00096381 predicted 2503
6 SASI_Mm01_00096382 predicted 2925
7 SASI_Mm01_00096383 predicted 1341
8 SASI_Mm01_00096384 predicted 924
9 SASI_Mm01_00096385 predicted 1192
10 SASI_Mm01_00096386 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002115
HK3 MISSION shRNA Bacterial Glycerol Stock
hexokinase 3 (white cell)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2257s1c1
Sequence:CCGGGCACCCGCTTTGATGCAAGTGCTCGAGCACTTGCATCAAAGCGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1206s1c1
Sequence:CCGGGCTTCGGATGTTGAGCTTGTGCTCGAGCACAAGCTCAACATCCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2742s1c1
Sequence:CCGGCCTCGCTGTGTGGTCACGTTCCTCGAGGAACGTGACCACACAGCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002115.1-2902s1c1
Sequence:CCGGGTCTGCCTGTTTCCCAGCCAGCTCGAGCTGGCTGGGAAACAGGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-932s1c1
Sequence:CCGGGCTGACCACCTTCGACCATACCTCGAGGTATGGTCGAAGGTGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1420s1c1
Sequence:CCGGCGGAATGCGATGTCTCCTTAACTCGAGTTAAGGAGACATCGCATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1748s1c1
Sequence:CCGGCGTGCAGATCACCAGCGAGATCTCGAGATCTCGCTGGTGATCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1539s1c1
Sequence:CCGGCCATTCCGGTTGAACCATGATCTCGAGATCATGGTTCAACCGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-560s1c1
Sequence:CCGGGCTTGGCTTCAGCTTCTCTTTCTCGAGAAAGAGAAGCTGAAGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002115.1-780s1c1
Sequence:CCGGCCGTGTGAGGTTGGGCTAGTTCTCGAGAACTAGCCCAACCTCACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002115
HK3 MISSION shRNA shRNA Plasmid DNA
hexokinase 3 (white cell)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2257s1c1
Sequence:CCGGGCACCCGCTTTGATGCAAGTGCTCGAGCACTTGCATCAAAGCGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1206s1c1
Sequence:CCGGGCTTCGGATGTTGAGCTTGTGCTCGAGCACAAGCTCAACATCCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2742s1c1
Sequence:CCGGCCTCGCTGTGTGGTCACGTTCCTCGAGGAACGTGACCACACAGCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002115.1-2902s1c1
Sequence:CCGGGTCTGCCTGTTTCCCAGCCAGCTCGAGCTGGCTGGGAAACAGGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-932s1c1
Sequence:CCGGGCTGACCACCTTCGACCATACCTCGAGGTATGGTCGAAGGTGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1420s1c1
Sequence:CCGGCGGAATGCGATGTCTCCTTAACTCGAGTTAAGGAGACATCGCATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1748s1c1
Sequence:CCGGCGTGCAGATCACCAGCGAGATCTCGAGATCTCGCTGGTGATCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1539s1c1
Sequence:CCGGCCATTCCGGTTGAACCATGATCTCGAGATCATGGTTCAACCGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-560s1c1
Sequence:CCGGGCTTGGCTTCAGCTTCTCTTTCTCGAGAAAGAGAAGCTGAAGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002115.1-780s1c1
Sequence:CCGGCCGTGTGAGGTTGGGCTAGTTCTCGAGAACTAGCCCAACCTCACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002115
HK3 MISSION shRNA Lentiviral Transduction Particles
hexokinase 3 (white cell)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2257s1c1
Sequence:CCGGGCACCCGCTTTGATGCAAGTGCTCGAGCACTTGCATCAAAGCGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1206s1c1
Sequence:CCGGGCTTCGGATGTTGAGCTTGTGCTCGAGCACAAGCTCAACATCCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-2742s1c1
Sequence:CCGGCCTCGCTGTGTGGTCACGTTCCTCGAGGAACGTGACCACACAGCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002115.1-2902s1c1
Sequence:CCGGGTCTGCCTGTTTCCCAGCCAGCTCGAGCTGGCTGGGAAACAGGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-932s1c1
Sequence:CCGGGCTGACCACCTTCGACCATACCTCGAGGTATGGTCGAAGGTGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1420s1c1
Sequence:CCGGCGGAATGCGATGTCTCCTTAACTCGAGTTAAGGAGACATCGCATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1748s1c1
Sequence:CCGGCGTGCAGATCACCAGCGAGATCTCGAGATCTCGCTGGTGATCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-1539s1c1
Sequence:CCGGCCATTCCGGTTGAACCATGATCTCGAGATCATGGTTCAACCGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002115.1-560s1c1
Sequence:CCGGGCTTGGCTTCAGCTTCTCTTTCTCGAGAAAGAGAAGCTGAAGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002115.1-780s1c1
Sequence:CCGGCCGTGTGAGGTTGGGCTAGTTCTCGAGAACTAGCCCAACCTCACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127381
HK3 MISSION shRNA Bacterial Glycerol Stock
hexokinase 3 (white cell)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2830s1c1
Sequence:CCGGGCATCCATCAATCCAGGCAAACTCGAGTTTGCCTGGATTGATGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2400s1c1
Sequence:CCGGCCTGGACCAGAGATACACAAACTCGAGTTTGTGTATCTCTGGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-913s1c1
Sequence:CCGGCGGGAGTTTGTGATTCCTCAACTCGAGTTGAGGAATCACAAACTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1143s1c1
Sequence:CCGGCCAGTTGCTAAGAGATGCCATCTCGAGATGGCATCTCTTAGCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1858s1c1
Sequence:CCGGCGAATCCTAAAGGAGACGGTACTCGAGTACCGTCTCCTTTAGGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127381
HK3 MISSION shRNA shRNA Plasmid DNA
hexokinase 3 (white cell)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2830s1c1
Sequence:CCGGGCATCCATCAATCCAGGCAAACTCGAGTTTGCCTGGATTGATGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2400s1c1
Sequence:CCGGCCTGGACCAGAGATACACAAACTCGAGTTTGTGTATCTCTGGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-913s1c1
Sequence:CCGGCGGGAGTTTGTGATTCCTCAACTCGAGTTGAGGAATCACAAACTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1143s1c1
Sequence:CCGGCCAGTTGCTAAGAGATGCCATCTCGAGATGGCATCTCTTAGCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1858s1c1
Sequence:CCGGCGAATCCTAAAGGAGACGGTACTCGAGTACCGTCTCCTTTAGGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127381
HK3 MISSION shRNA Lentiviral Transduction Particles
hexokinase 3 (white cell)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2830s1c1
Sequence:CCGGGCATCCATCAATCCAGGCAAACTCGAGTTTGCCTGGATTGATGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-2400s1c1
Sequence:CCGGCCTGGACCAGAGATACACAAACTCGAGTTTGTGTATCTCTGGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-913s1c1
Sequence:CCGGCGGGAGTTTGTGATTCCTCAACTCGAGTTGAGGAATCACAAACTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1143s1c1
Sequence:CCGGCCAGTTGCTAAGAGATGCCATCTCGAGATGGCATCTCTTAGCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127381.3-1858s1c1
Sequence:CCGGCGAATCCTAAAGGAGACGGTACTCGAGTACCGTCTCCTTTAGGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033245
HK3 MISSION shRNA Bacterial Glycerol Stock
hexokinase 3 (white cell)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2120s21c1
Sequence:CCGGAGGATGTTGTGTATCTATTACCTCGAGGTAATAGATACACAACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1942s21c1
Sequence:CCGGCAGAAGCTCTTTGACCATATTCTCGAGAATATGGTCAAAGAGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2071s21c1
Sequence:CCGGATCCTCCTGAATTGGACTAAGCTCGAGCTTAGTCCAATTCAGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1509s21c1
Sequence:CCGGCAGGTTCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033245
HK3 MISSION shRNA shRNA Plasmid DNA
hexokinase 3 (white cell)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2120s21c1
Sequence:CCGGAGGATGTTGTGTATCTATTACCTCGAGGTAATAGATACACAACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1942s21c1
Sequence:CCGGCAGAAGCTCTTTGACCATATTCTCGAGAATATGGTCAAAGAGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2071s21c1
Sequence:CCGGATCCTCCTGAATTGGACTAAGCTCGAGCTTAGTCCAATTCAGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1509s21c1
Sequence:CCGGCAGGTTCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033245
HK3 MISSION shRNA Lentiviral Transduction Particles
hexokinase 3 (white cell)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2120s21c1
Sequence:CCGGAGGATGTTGTGTATCTATTACCTCGAGGTAATAGATACACAACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1942s21c1
Sequence:CCGGCAGAAGCTCTTTGACCATATTCTCGAGAATATGGTCAAAGAGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-2071s21c1
Sequence:CCGGATCCTCCTGAATTGGACTAAGCTCGAGCTTAGTCCAATTCAGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033245.3-1509s21c1
Sequence:CCGGCAGGTTCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)