EMAIL THIS PAGE TO A FRIEND

HKDC1

hexokinase domain containing 1

101 Gene Product Result for
Gene ID:
Mouse(216019) hexokinase domain containing 1
Zebrafish(321224) hexokinase domain containing 1
domestic cat(101094295) hexokinase domain containing 1
cow(614824) hexokinase domain containing 1
Horse(100072686) hexokinase domain containing 1
dog(489019) hexokinase domain containing 1
chicken(423698) hexokinase domain containing 1
domestic guinea pig(100729828) hexokinase domain containing 1
naked mole-rat(101708521) hexokinase domain containing 1
sheep(101107841) hexokinase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025130 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068271 MISSION® esiRNA esiRNA human HKDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025130 Rosetta Predictions human pricing
NM_145419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213759 predicted 2043
2 SASI_Hs02_00357839 predicted 540
3 SASI_Hs02_00357840 predicted 2774
4 SASI_Hs01_00213761 predicted 1384
5 SASI_Hs02_00357841 predicted 2862
6 SASI_Hs01_00213762 predicted 2936
7 SASI_Hs01_00213763 predicted 2148
8 SASI_Hs01_00213764 predicted 2174
9 SASI_Hs01_00213765 predicted 2186
10 SASI_Hs01_00213766 predicted 653
11 SASI_Hs01_00213758 predicted 550
12 SASI_Hs01_00213760 predicted 2910
13 SASI_Hs01_00213767 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122693 predicted 2002
2 SASI_Mm01_00122694 predicted 358
3 SASI_Mm01_00122695 predicted 1802
4 SASI_Mm01_00122697 predicted 803
5 SASI_Mm01_00122698 predicted 2530
6 SASI_Mm01_00122699 predicted 2120
7 SASI_Mm01_00122700 predicted 777
8 SASI_Mm01_00122701 predicted 368
9 SASI_Mm01_00122702 predicted 1149
10 SASI_Mm02_00340767 predicted 2225
11 SASI_Mm01_00122696 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025130
VALIDATED
HKDC1 MISSION shRNA Bacterial Glycerol Stock
hexokinase domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2079s21c1
Sequence:GTACCGGACATTGTTGCAGTCGTGAATGCTCGAGCATTCACGACTGCAACAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2052s21c1
Sequence:GTACCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-1176s21c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025130.3-3300s21c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-448s21c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-2779s21c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-3300s1c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025130.2-1177s1c1
Sequence:CCGGCCTTGCTAATACAAGAGAGATCTCGAGATCTCTCTTGTATTAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-2779s1c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-448s1c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-1176s1c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025130
VALIDATED
HKDC1 MISSION shRNA shRNA Plasmid DNA
hexokinase domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2079s21c1
Sequence:GTACCGGACATTGTTGCAGTCGTGAATGCTCGAGCATTCACGACTGCAACAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2052s21c1
Sequence:GTACCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-1176s21c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025130.3-3300s21c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-448s21c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-2779s21c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-3300s1c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025130.2-1177s1c1
Sequence:CCGGCCTTGCTAATACAAGAGAGATCTCGAGATCTCTCTTGTATTAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-2779s1c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-448s1c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-1176s1c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025130
VALIDATED
HKDC1 MISSION shRNA Lentiviral Transduction Particles
hexokinase domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2079s21c1
Sequence:GTACCGGACATTGTTGCAGTCGTGAATGCTCGAGCATTCACGACTGCAACAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025130.3-2052s21c1
Sequence:GTACCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-1176s21c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025130.3-3300s21c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-448s21c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025130.3-2779s21c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-3300s1c1
Sequence:CCGGCCTGTACTTGTGGATGAACATCTCGAGATGTTCATCCACAAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025130.2-1177s1c1
Sequence:CCGGCCTTGCTAATACAAGAGAGATCTCGAGATCTCTCTTGTATTAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-2779s1c1
Sequence:CCGGCCCTCGATGTGATGTGACATTCTCGAGAATGTCACATCACATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-448s1c1
Sequence:CCGGGCAGATGGAGAGTCAGTTCTACTCGAGTAGAACTGACTCTCCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025130.2-1176s1c1
Sequence:CCGGGCCTTGCTAATACAAGAGAGACTCGAGTCTCTCTTGTATTAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145419
HKDC1 MISSION shRNA Bacterial Glycerol Stock
hexokinase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-2010s21c1
Sequence:CCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-763s21c1
Sequence:CCGGCAACTGTGAAGTCGGCGTTATCTCGAGATAACGCCGACTTCACAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145419.1-2953s21c1
Sequence:CCGGGCACCTCCATTTGGCATATTTCTCGAGAAATATGCCAAATGGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-348s21c1
Sequence:CCGGATCTCGGAGGATCCAAGTTTCCTCGAGGAAACTTGGATCCTCCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2137s1c1
Sequence:CCGGCGTGTGCTACATGGAGGAAATCTCGAGATTTCCTCCATGTAGCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-442s1c1
Sequence:CCGGCAATGAAATCACCCGTGGGAACTCGAGTTCCCACGGGTGATTTCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2750s1c1
Sequence:CCGGGTGACATTTATGTTGTCAGAACTCGAGTTCTGACAACATAAATGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1747s1c1
Sequence:CCGGGCGCATGTACAACAAGATCTTCTCGAGAAGATCTTGTTGTACATGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1037s1c1
Sequence:CCGGGCCAAAGTTGGTCTCCTGTTTCTCGAGAAACAGGAGACCAACTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145419
HKDC1 MISSION shRNA shRNA Plasmid DNA
hexokinase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-2010s21c1
Sequence:CCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-763s21c1
Sequence:CCGGCAACTGTGAAGTCGGCGTTATCTCGAGATAACGCCGACTTCACAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145419.1-2953s21c1
Sequence:CCGGGCACCTCCATTTGGCATATTTCTCGAGAAATATGCCAAATGGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-348s21c1
Sequence:CCGGATCTCGGAGGATCCAAGTTTCCTCGAGGAAACTTGGATCCTCCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2137s1c1
Sequence:CCGGCGTGTGCTACATGGAGGAAATCTCGAGATTTCCTCCATGTAGCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-442s1c1
Sequence:CCGGCAATGAAATCACCCGTGGGAACTCGAGTTCCCACGGGTGATTTCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2750s1c1
Sequence:CCGGGTGACATTTATGTTGTCAGAACTCGAGTTCTGACAACATAAATGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1747s1c1
Sequence:CCGGGCGCATGTACAACAAGATCTTCTCGAGAAGATCTTGTTGTACATGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1037s1c1
Sequence:CCGGGCCAAAGTTGGTCTCCTGTTTCTCGAGAAACAGGAGACCAACTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145419
HKDC1 MISSION shRNA Lentiviral Transduction Particles
hexokinase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-2010s21c1
Sequence:CCGGTCAAGAGGAGAAACGAGTTTGCTCGAGCAAACTCGTTTCTCCTCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-763s21c1
Sequence:CCGGCAACTGTGAAGTCGGCGTTATCTCGAGATAACGCCGACTTCACAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145419.1-2953s21c1
Sequence:CCGGGCACCTCCATTTGGCATATTTCTCGAGAAATATGCCAAATGGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145419.1-348s21c1
Sequence:CCGGATCTCGGAGGATCCAAGTTTCCTCGAGGAAACTTGGATCCTCCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2137s1c1
Sequence:CCGGCGTGTGCTACATGGAGGAAATCTCGAGATTTCCTCCATGTAGCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-442s1c1
Sequence:CCGGCAATGAAATCACCCGTGGGAACTCGAGTTCCCACGGGTGATTTCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-2750s1c1
Sequence:CCGGGTGACATTTATGTTGTCAGAACTCGAGTTCTGACAACATAAATGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1747s1c1
Sequence:CCGGGCGCATGTACAACAAGATCTTCTCGAGAAGATCTTGTTGTACATGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145419.1-1037s1c1
Sequence:CCGGGCCAAAGTTGGTCTCCTGTTTCTCGAGAAACAGGAGACCAACTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)