EMAIL THIS PAGE TO A FRIEND

HKR1

HKR1, GLI-Kruppel zinc finger family member

30 Gene Product Result for
Synonyms: ZNF875
UniProtKB ID: P10072, A8MRS7, Q6PJD0, Q9BSW9, Q9UM09
Gene ID:
Mouse(110189) GLI-Kruppel family member HKR1
dog(484542) HKR1, GLI-Kruppel zinc finger family member
cow(787074) HKR1, GLI-Kruppel zinc finger family member
sheep(101107890) HKR1, GLI-Kruppel zinc finger family member
naked mole-rat(101723769) HKR1, GLI-Kruppel zinc finger family member
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181786 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070041 MISSION® esiRNA esiRNA human HKR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156587 predicted 953
2 SASI_Hs01_00156588 predicted 750
3 SASI_Hs02_00370388 predicted 2195
4 SASI_Hs01_00156589 predicted 1277
5 SASI_Hs01_00156590 predicted 1494
6 SASI_Hs01_00156591 predicted 2241
7 SASI_Hs01_00156593 predicted 1543
8 SASI_Hs01_00156594 predicted 1185
9 SASI_Hs01_00156595 predicted 1595
10 SASI_Hs02_00370389 predicted 2034
11 SASI_Hs01_00156592 predicted 2251
12 SASI_Hs01_00156596 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181786
HKR1 MISSION shRNA Bacterial Glycerol Stock
HKR1, GLI-Kruppel zinc finger family member
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2037s21c1
Sequence:CCGGGCTAAGTTAACTCTCATTAAACTCGAGTTTAATGAGAGTTAACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-759s1c1
Sequence:CCGGCCATTCTGCTTTAGTGGCAAACTCGAGTTTGCCACTAAAGCAGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-579s1c1
Sequence:CCGGCCAGAATCGAAGCCAGAAATTCTCGAGAATTTCTGGCTTCGATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-1707s1c1
Sequence:CCGGCTGAAGTCAAACCTTAACAAACTCGAGTTTGTTAAGGTTTGACTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-811s1c1
Sequence:CCGGGACTCCTGTTTGGGAGAGTAACTCGAGTTACTCTCCCAAACAGGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-1600s21c1
Sequence:CCGGCAGAATGTGGGCGTCACTTTACTCGAGTAAAGTGACGCCCACATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2201s21c1
Sequence:CCGGTAGTCGGAAGTCCAACCTTATCTCGAGATAAGGTTGGACTTCCGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181786.2-2753s21c1
Sequence:CCGGACAAATCAGTCAACGTGTATTCTCGAGAATACACGTTGACTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-901s21c1
Sequence:CCGGACAACACAGTGGTGGATATAGCTCGAGCTATATCCACCACTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181786
HKR1 MISSION shRNA shRNA Plasmid DNA
HKR1, GLI-Kruppel zinc finger family member
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2037s21c1
Sequence:CCGGGCTAAGTTAACTCTCATTAAACTCGAGTTTAATGAGAGTTAACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-759s1c1
Sequence:CCGGCCATTCTGCTTTAGTGGCAAACTCGAGTTTGCCACTAAAGCAGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-579s1c1
Sequence:CCGGCCAGAATCGAAGCCAGAAATTCTCGAGAATTTCTGGCTTCGATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-1707s1c1
Sequence:CCGGCTGAAGTCAAACCTTAACAAACTCGAGTTTGTTAAGGTTTGACTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-811s1c1
Sequence:CCGGGACTCCTGTTTGGGAGAGTAACTCGAGTTACTCTCCCAAACAGGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-1600s21c1
Sequence:CCGGCAGAATGTGGGCGTCACTTTACTCGAGTAAAGTGACGCCCACATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2201s21c1
Sequence:CCGGTAGTCGGAAGTCCAACCTTATCTCGAGATAAGGTTGGACTTCCGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181786.2-2753s21c1
Sequence:CCGGACAAATCAGTCAACGTGTATTCTCGAGAATACACGTTGACTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-901s21c1
Sequence:CCGGACAACACAGTGGTGGATATAGCTCGAGCTATATCCACCACTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181786
HKR1 MISSION shRNA Lentiviral Transduction Particles
HKR1, GLI-Kruppel zinc finger family member
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2037s21c1
Sequence:CCGGGCTAAGTTAACTCTCATTAAACTCGAGTTTAATGAGAGTTAACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-759s1c1
Sequence:CCGGCCATTCTGCTTTAGTGGCAAACTCGAGTTTGCCACTAAAGCAGAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-579s1c1
Sequence:CCGGCCAGAATCGAAGCCAGAAATTCTCGAGAATTTCTGGCTTCGATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-1707s1c1
Sequence:CCGGCTGAAGTCAAACCTTAACAAACTCGAGTTTGTTAAGGTTTGACTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181786.2-811s1c1
Sequence:CCGGGACTCCTGTTTGGGAGAGTAACTCGAGTTACTCTCCCAAACAGGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-1600s21c1
Sequence:CCGGCAGAATGTGGGCGTCACTTTACTCGAGTAAAGTGACGCCCACATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-2201s21c1
Sequence:CCGGTAGTCGGAAGTCCAACCTTATCTCGAGATAAGGTTGGACTTCCGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181786.2-2753s21c1
Sequence:CCGGACAAATCAGTCAACGTGTATTCTCGAGAATACACGTTGACTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181786.2-901s21c1
Sequence:CCGGACAACACAGTGGTGGATATAGCTCGAGCTATATCCACCACTGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)