EMAIL THIS PAGE TO A FRIEND

HLA-A

major histocompatibility complex, class I, A

71 Gene Product Result for
Synonyms: HLAA
Species: Human HLA-A(3105)
UniProtKB ID: P16190, O02939, O02954
Gene ID:
Human(3105) Summary: HLA-A belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-A alleles have been described. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405936 Anti-HLA-A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4700632 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-81, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700633 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700635 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
H1650 Monoclonal Anti-HLA Class I Antigen antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence, immunoprecipitation (IP) pricing
F5662 Monoclonal Anti-HLA Class I Antigen−FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence pricing
SAB4700637 Monoclonal Anti-HLA Class I, low endotoxin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700638 Monoclonal Anti-HLA Class I-Biotin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700639 Monoclonal Anti-HLA Class I-FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700634 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700636 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700640 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, nonhuman primates, feline, bovine
flow cytometry pricing
SAB4700298 Monoclonal Anti-HLA-A2 azide free antibody produced in mouse clone BB7.2, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunoprecipitation (IP) pricing
SAB4700299 Monoclonal Anti-HLA-A2-PE antibody produced in mouse clone BB7.2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002116 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067355 predicted 1024
2 SASI_Hs01_00067362 predicted 248
3 SASI_Hs01_00067363 predicted 1077
4 SASI_Hs01_00067356 predicted 340
5 SASI_Hs01_00067364 predicted 982
6 SASI_Hs01_00067358 predicted 1024
7 SASI_Hs01_00067359 predicted 1082
8 SASI_Hs01_00067360 predicted 1114
9 SASI_Hs01_00067361 predicted 1190
10 SASI_Hs02_00333239 predicted 1427
11 SASI_Hs01_00067357 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002116
VALIDATED
HLA-A MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002116.5-1142s21c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-349s21c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-255s21c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-78s21c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-1142s1c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-255s1c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-357s1c1
Sequence:CCGGCCAGATAATGTATGGCTGCGACTCGAGTCGCAGCCATACATTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-349s1c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002116
VALIDATED
HLA-A MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002116.5-1142s21c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-349s21c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-255s21c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-78s21c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-1142s1c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-255s1c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-357s1c1
Sequence:CCGGCCAGATAATGTATGGCTGCGACTCGAGTCGCAGCCATACATTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-349s1c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002116
VALIDATED
HLA-A MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002116.5-1142s21c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-349s21c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-255s21c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002116.5-78s21c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-1142s1c1
Sequence:CCGGCCCTTCCCTTTGTGACTTGAACTCGAGTTCAAGTCACAAAGGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTTCTCGAGAAGAAATACCTCATGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-255s1c1
Sequence:CCGGCCAGGAGACACGGAATGTGAACTCGAGTTCACATTCCGTGTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002116.5-357s1c1
Sequence:CCGGCCAGATAATGTATGGCTGCGACTCGAGTCGCAGCCATACATTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002116.5-349s1c1
Sequence:CCGGCACACCATCCAGATAATGTATCTCGAGATACATTATCTGGATGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)