EMAIL THIS PAGE TO A FRIEND

HLA-C

major histocompatibility complex, class I, C

53 Gene Product Result for
Synonyms: D6S204 HLA-JY3 HLC-C PSORS1
Species: Human HLA-C(3107)
Gene ID:
Human(3107) Summary: HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Over one hundred HLA-C alleles have been described [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405938 Anti-HLA-C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107752 Anti-HLA-C antibody produced in rabbit affinity isolated antibody human, rabbit, pig
western blot pricing
SAB4700632 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-81, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700633 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700635 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
H1650 Monoclonal Anti-HLA Class I Antigen antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence, immunoprecipitation (IP) pricing
F5662 Monoclonal Anti-HLA Class I Antigen−FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence pricing
SAB4700637 Monoclonal Anti-HLA Class I, low endotoxin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700638 Monoclonal Anti-HLA Class I-Biotin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700639 Monoclonal Anti-HLA Class I-FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700634 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700636 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700640 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, nonhuman primates, feline, bovine
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002117 Rosetta Predictions human pricing
XM_001715881 Rosetta Predictions human pricing
XM_001717045 Rosetta Predictions human pricing
XM_001719879 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203972 predicted 1075
2 SASI_Hs01_00203973 predicted 1083
3 SASI_Hs01_00203974 predicted 979
4 SASI_Hs01_00203975 predicted 981
5 SASI_Hs01_00203976 predicted 1067
6 SASI_Hs02_00333240 predicted 408
7 SASI_Hs01_00203977 predicted 272
8 SASI_Hs02_00333241 predicted 892
9 SASI_Hs01_00203978 predicted 263
10 SASI_Hs02_00333242 predicted 1397
11 SASI_Hs01_00203971 predicted 999
12 SASI_Hs01_00203979 predicted 997
13 SASI_Hs01_00203980 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406743 predicted 1172
2 SASI_Hs02_00406744 predicted 1184
3 SASI_Hs02_00406745 predicted 1178
4 SASI_Hs02_00406746 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414680 predicted 1172
2 SASI_Hs02_00414681 predicted 1182
3 SASI_Hs02_00414682 predicted 612
4 SASI_Hs02_00414683 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433153 predicted 1215
2 SASI_Hs02_00433154 predicted 1215
3 SASI_Hs02_00433155 predicted 1219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002117
VALIDATED
HLA-C MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-960s21c1
Sequence:CCGGTGGTTGTCCTAGCTGTCCTTGCTCGAGCAAGGACAGCTAGGACAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-1081s21c1
Sequence:CCGGTGAGTCTCTCATCACTTGTAACTCGAGTTACAAGTGATGAGAGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-261s21c1
Sequence:CCGGACCGGGAGACACAGAAGTACACTCGAGTGTACTTCTGTGTCTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-1091s21c1
Sequence:CCGGATCACTTGTAAAGCCTGAGACCTCGAGGTCTCAGGCTTTACAAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-982s21c1
Sequence:CCGGAGCTGTGGTCACCGCTATGATCTCGAGATCATAGCGGTGACCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1383s1c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-841s1c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-994s1c1
Sequence:CCGGCGCTATGATGTGTAGGAGGAACTCGAGTTCCTCCTACACATCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1082s1c1
Sequence:CCGGGAGTCTCTCATCACTTGTAAACTCGAGTTTACAAGTGATGAGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-439s1c1
Sequence:CCGGCAAGGATTACATCGCCCTGAACTCGAGTTCAGGGCGATGTAATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002117.4-1383s21c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-841s21c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002117
VALIDATED
HLA-C MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-960s21c1
Sequence:CCGGTGGTTGTCCTAGCTGTCCTTGCTCGAGCAAGGACAGCTAGGACAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-1081s21c1
Sequence:CCGGTGAGTCTCTCATCACTTGTAACTCGAGTTACAAGTGATGAGAGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-261s21c1
Sequence:CCGGACCGGGAGACACAGAAGTACACTCGAGTGTACTTCTGTGTCTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-1091s21c1
Sequence:CCGGATCACTTGTAAAGCCTGAGACCTCGAGGTCTCAGGCTTTACAAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-982s21c1
Sequence:CCGGAGCTGTGGTCACCGCTATGATCTCGAGATCATAGCGGTGACCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1383s1c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-841s1c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-994s1c1
Sequence:CCGGCGCTATGATGTGTAGGAGGAACTCGAGTTCCTCCTACACATCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1082s1c1
Sequence:CCGGGAGTCTCTCATCACTTGTAAACTCGAGTTTACAAGTGATGAGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-439s1c1
Sequence:CCGGCAAGGATTACATCGCCCTGAACTCGAGTTCAGGGCGATGTAATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002117.4-1383s21c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-841s21c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002117
VALIDATED
HLA-C MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-960s21c1
Sequence:CCGGTGGTTGTCCTAGCTGTCCTTGCTCGAGCAAGGACAGCTAGGACAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-1081s21c1
Sequence:CCGGTGAGTCTCTCATCACTTGTAACTCGAGTTACAAGTGATGAGAGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-261s21c1
Sequence:CCGGACCGGGAGACACAGAAGTACACTCGAGTGTACTTCTGTGTCTCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-1091s21c1
Sequence:CCGGATCACTTGTAAAGCCTGAGACCTCGAGGTCTCAGGCTTTACAAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002117.4-982s21c1
Sequence:CCGGAGCTGTGGTCACCGCTATGATCTCGAGATCATAGCGGTGACCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1383s1c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-841s1c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-994s1c1
Sequence:CCGGCGCTATGATGTGTAGGAGGAACTCGAGTTCCTCCTACACATCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002117.4-1082s1c1
Sequence:CCGGGAGTCTCTCATCACTTGTAAACTCGAGTTTACAAGTGATGAGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002117.4-439s1c1
Sequence:CCGGCAAGGATTACATCGCCCTGAACTCGAGTTCAGGGCGATGTAATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002117.4-1383s21c1
Sequence:CCGGGCAACTTCTTACTTCCCTAATCTCGAGATTAGGGAAGTAAGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002117.4-841s21c1
Sequence:CCGGGCAGAGATACACGTGCCATATCTCGAGATATGGCACGTGTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)