EMAIL THIS PAGE TO A FRIEND

HLA-DMA

major histocompatibility complex, class II, DM alpha

22 Gene Product Result for
Synonyms: D6S222E DMA HLADM RING6
Species: Human HLA-DMA(3108)
UniProtKB ID: P28067, Q29639, Q29640
Gene ID:
Human(3108) Summary: HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006120 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146752 predicted 413
2 SASI_Hs01_00146753 predicted 517
3 SASI_Hs01_00146754 predicted 498
4 SASI_Hs01_00146755 predicted 668
5 SASI_Hs01_00146756 predicted 653
6 SASI_Hs01_00146757 predicted 617
7 SASI_Hs01_00146758 predicted 292
8 SASI_Hs01_00146759 predicted 814
9 SASI_Hs02_00340946 predicted 466
10 SASI_Hs01_00146760 predicted 649
11 SASI_Hs01_00146761 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006120
HLA-DMA MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DM alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006120.3-952s21c1
Sequence:CCGGGATCTCCTCTTAGGGTAGAAGCTCGAGCTTCTACCCTAAGAGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-657s1c1
Sequence:CCGGGACTCACGAAATTGACCGCTACTCGAGTAGCGGTCAATTTCGTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006120.2-873s1c1
Sequence:CCGGCAAACAGAGGATGCTCAGATTCTCGAGAATCTGAGCATCCTCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-786s1c1
Sequence:CCGGCATTGTTCTCATCATCTACTTCTCGAGAAGTAGATGATGAGAACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-369s1c1
Sequence:CCGGGATCCAGCAAATAGGGCCAAACTCGAGTTTGGCCCTATTTGCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-560s21c1
Sequence:CCGGAGTGAACTGGCAGCATCATTCCTCGAGGAATGATGCTGCCAGTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-664s21c1
Sequence:CCGGCACCAGAACCTTCTGACATTTCTCGAGAAATGTCAGAAGGTTCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-361s21c1
Sequence:CCGGAGGGAGATGCTCCTGCCATTTCTCGAGAAATGGCAGGAGCATCTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006120
HLA-DMA MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DM alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006120.3-952s21c1
Sequence:CCGGGATCTCCTCTTAGGGTAGAAGCTCGAGCTTCTACCCTAAGAGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-657s1c1
Sequence:CCGGGACTCACGAAATTGACCGCTACTCGAGTAGCGGTCAATTTCGTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006120.2-873s1c1
Sequence:CCGGCAAACAGAGGATGCTCAGATTCTCGAGAATCTGAGCATCCTCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-786s1c1
Sequence:CCGGCATTGTTCTCATCATCTACTTCTCGAGAAGTAGATGATGAGAACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-369s1c1
Sequence:CCGGGATCCAGCAAATAGGGCCAAACTCGAGTTTGGCCCTATTTGCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-560s21c1
Sequence:CCGGAGTGAACTGGCAGCATCATTCCTCGAGGAATGATGCTGCCAGTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-664s21c1
Sequence:CCGGCACCAGAACCTTCTGACATTTCTCGAGAAATGTCAGAAGGTTCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-361s21c1
Sequence:CCGGAGGGAGATGCTCCTGCCATTTCTCGAGAAATGGCAGGAGCATCTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006120
HLA-DMA MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DM alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006120.3-952s21c1
Sequence:CCGGGATCTCCTCTTAGGGTAGAAGCTCGAGCTTCTACCCTAAGAGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-657s1c1
Sequence:CCGGGACTCACGAAATTGACCGCTACTCGAGTAGCGGTCAATTTCGTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006120.2-873s1c1
Sequence:CCGGCAAACAGAGGATGCTCAGATTCTCGAGAATCTGAGCATCCTCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-786s1c1
Sequence:CCGGCATTGTTCTCATCATCTACTTCTCGAGAAGTAGATGATGAGAACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006120.2-369s1c1
Sequence:CCGGGATCCAGCAAATAGGGCCAAACTCGAGTTTGGCCCTATTTGCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-560s21c1
Sequence:CCGGAGTGAACTGGCAGCATCATTCCTCGAGGAATGATGCTGCCAGTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-664s21c1
Sequence:CCGGCACCAGAACCTTCTGACATTTCTCGAGAAATGTCAGAAGGTTCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006120.3-361s21c1
Sequence:CCGGAGGGAGATGCTCCTGCCATTTCTCGAGAAATGGCAGGAGCATCTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)