EMAIL THIS PAGE TO A FRIEND

HLA-DMB

major histocompatibility complex, class II, DM beta

110 Gene Product Result for
Synonyms: D6S221E RING7
Species: Human HLA-DMB(3109)
Gene ID:
Human(3109) Summary: HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002118 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002118 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024637 predicted 1030
2 SASI_Hs01_00024638 predicted 618
3 SASI_Hs01_00024640 predicted 574
4 SASI_Hs01_00024641 predicted 793
5 SASI_Hs01_00024642 predicted 331
6 SASI_Hs01_00024643 predicted 676
7 SASI_Hs01_00024644 predicted 1105
8 SASI_Hs01_00024645 predicted 641
9 SASI_Hs01_00024646 predicted 1061
10 SASI_Hs02_00333243 predicted 1075
11 SASI_Hs01_00024639 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002118
VALIDATED
HLA-DMB MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DM beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-435s21c1
Sequence:CCGGGTGCTGAATAGCTTGGCGAATCTCGAGATTCGCCAAGCTATTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-338s21c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-338s1c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-652s1c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-652s21c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-965s21c1
Sequence:CCGGCCACTCTAGTTACACTCCTCTCTCGAGAGAGGAGTGTAACTAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002118
VALIDATED
HLA-DMB MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DM beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-435s21c1
Sequence:CCGGGTGCTGAATAGCTTGGCGAATCTCGAGATTCGCCAAGCTATTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-338s21c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-338s1c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-652s1c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-652s21c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-965s21c1
Sequence:CCGGCCACTCTAGTTACACTCCTCTCTCGAGAGAGGAGTGTAACTAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002118
VALIDATED
HLA-DMB MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DM beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-435s21c1
Sequence:CCGGGTGCTGAATAGCTTGGCGAATCTCGAGATTCGCCAAGCTATTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-338s21c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-338s1c1
Sequence:CCGGGACTCCAAAGGATTTCACATACTCGAGTATGTGAAATCCTTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002118.3-652s1c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-652s21c1
Sequence:CCGGTCTATCCAGCAGAAGTGACTACTCGAGTAGTCACTTCTGCTGGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002118.3-965s21c1
Sequence:CCGGCCACTCTAGTTACACTCCTCTCTCGAGAGAGGAGTGTAACTAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)