EMAIL THIS PAGE TO A FRIEND

HLA-DOA

major histocompatibility complex, class II, DO alpha

72 Gene Product Result for
Synonyms: HLA-DNA HLA-DZA HLADZ
Species: Human HLA-DOA(3111)
Gene ID:
Human(3111) Summary: HLA-DOA belongs to the HLA class II alpha chain paralogues. HLA-DOA forms a heterodimer with HLA-DOB. The heterodimer, HLA-DO, is found in lysosomes in B cells and regulates HLA-DM-mediated peptide loading on MHC class II molecules. In comparison with classical HLA class II molecules, this gene exhibits very little sequence variation, especially at the protein level. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002119 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002119 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030802 predicted 935
2 SASI_Hs01_00030803 predicted 1281
3 SASI_Hs01_00030804 predicted 815
4 SASI_Hs02_00333244 predicted 1273
5 SASI_Hs01_00030805 predicted 902
6 SASI_Hs01_00030806 predicted 1280
7 SASI_Hs01_00030807 predicted 340
8 SASI_Hs02_00333245 predicted 930
9 SASI_Hs01_00030808 predicted 981
10 SASI_Hs01_00030809 predicted 1253
11 SASI_Hs01_00030810 predicted 1000
12 SASI_Hs01_00030811 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002119
HLA-DOA MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DO alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-735s1c1
Sequence:CCGGCCTCATCATCATGGGCACATACTCGAGTATGTGCCCATGATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-169s1c1
Sequence:CCGGACCCATGAATTTGATGAGGAACTCGAGTTCCTCATCAAATTCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-291s1c1
Sequence:CCGGCGCCGCAATCAAAGCCCATCTCTCGAGAGATGGGCTTTGATTGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-417s1c1
Sequence:CCGGCATCTGCATCGTGGACAACATCTCGAGATGTTGTCCACGATGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-525s1c1
Sequence:CCGGTGACCATTTGTTCCGCAAGTTCTCGAGAACTTGCGGAACAAATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002119.3-298s21c1
Sequence:CCGGTGGTGACTTTGCCCGCTTTGACTCGAGTCAAAGCGGGCAAAGTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1070s21c1
Sequence:CCGGTCTGGCTGGCAGCACTAAATGCTCGAGCATTTAGTGCTGCCAGCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1247s21c1
Sequence:CCGGCACATGGACTTCATGAAATTTCTCGAGAAATTTCATGAAGTCCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002119
HLA-DOA MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DO alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-735s1c1
Sequence:CCGGCCTCATCATCATGGGCACATACTCGAGTATGTGCCCATGATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-169s1c1
Sequence:CCGGACCCATGAATTTGATGAGGAACTCGAGTTCCTCATCAAATTCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-291s1c1
Sequence:CCGGCGCCGCAATCAAAGCCCATCTCTCGAGAGATGGGCTTTGATTGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-417s1c1
Sequence:CCGGCATCTGCATCGTGGACAACATCTCGAGATGTTGTCCACGATGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-525s1c1
Sequence:CCGGTGACCATTTGTTCCGCAAGTTCTCGAGAACTTGCGGAACAAATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002119.3-298s21c1
Sequence:CCGGTGGTGACTTTGCCCGCTTTGACTCGAGTCAAAGCGGGCAAAGTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1070s21c1
Sequence:CCGGTCTGGCTGGCAGCACTAAATGCTCGAGCATTTAGTGCTGCCAGCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1247s21c1
Sequence:CCGGCACATGGACTTCATGAAATTTCTCGAGAAATTTCATGAAGTCCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002119
HLA-DOA MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DO alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-735s1c1
Sequence:CCGGCCTCATCATCATGGGCACATACTCGAGTATGTGCCCATGATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-169s1c1
Sequence:CCGGACCCATGAATTTGATGAGGAACTCGAGTTCCTCATCAAATTCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-291s1c1
Sequence:CCGGCGCCGCAATCAAAGCCCATCTCTCGAGAGATGGGCTTTGATTGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-417s1c1
Sequence:CCGGCATCTGCATCGTGGACAACATCTCGAGATGTTGTCCACGATGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002119.2-525s1c1
Sequence:CCGGTGACCATTTGTTCCGCAAGTTCTCGAGAACTTGCGGAACAAATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002119.3-298s21c1
Sequence:CCGGTGGTGACTTTGCCCGCTTTGACTCGAGTCAAAGCGGGCAAAGTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1070s21c1
Sequence:CCGGTCTGGCTGGCAGCACTAAATGCTCGAGCATTTAGTGCTGCCAGCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002119.3-1247s21c1
Sequence:CCGGCACATGGACTTCATGAAATTTCTCGAGAAATTTCATGAAGTCCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)