EMAIL THIS PAGE TO A FRIEND

HLA-DOB

major histocompatibility complex, class II, DO beta

19 Gene Product Result for
Synonyms: DOB
Species: Human HLA-DOB(3112)
UniProtKB ID: P13765, B0V0Y0, Q29746, Q29825, Q6FHC2
Gene ID:
Human(3112) Summary: HLA-DOB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DOA) and a beta chain (DOB), both anchored in the membrane. It is located in intracellular vesicles. DO suppresses peptide loading of MHC class II molecules by inhibiting HLA-DM. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002120 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110801 MISSION® esiRNA esiRNA human AL671681.4-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002120 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109502 predicted 1102
2 SASI_Hs01_00109504 predicted 272
3 SASI_Hs01_00109505 predicted 628
4 SASI_Hs01_00109506 predicted 245
5 SASI_Hs01_00109507 predicted 1107
6 SASI_Hs01_00109508 predicted 1013
7 SASI_Hs01_00109509 predicted 596
8 SASI_Hs01_00109510 predicted 1041
9 SASI_Hs01_00109511 predicted 645
10 SASI_Hs02_00333246 predicted 739
11 SASI_Hs01_00109503 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002120
HLA-DOB MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DO beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002120.3-990s21c1
Sequence:CCGGAGGACATTCATGAGGTCAATGCTCGAGCATTGACCTCATGAATGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002120.3-741s21c1
Sequence:CCGGGAGCTCAGTCTGAATATTCTTCTCGAGAAGAATATTCAGACTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-233s1c1
Sequence:CCGGCTTGGAGGAGTATGTACGTTTCTCGAGAAACGTACATACTCCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-615s1c1
Sequence:CCGGCTAGAAATGACTCCTGAACTTCTCGAGAAGTTCAGGAGTCATTTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-206s1c1
Sequence:CCGGGCAGTTTGTGGTCAGATTCATCTCGAGATGAATCTGACCACAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-809s1c1
Sequence:CCGGAGGATATGTGAGGACGCAGATCTCGAGATCTGCGTCCTCACATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002120
HLA-DOB MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DO beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002120.3-990s21c1
Sequence:CCGGAGGACATTCATGAGGTCAATGCTCGAGCATTGACCTCATGAATGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002120.3-741s21c1
Sequence:CCGGGAGCTCAGTCTGAATATTCTTCTCGAGAAGAATATTCAGACTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-233s1c1
Sequence:CCGGCTTGGAGGAGTATGTACGTTTCTCGAGAAACGTACATACTCCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-615s1c1
Sequence:CCGGCTAGAAATGACTCCTGAACTTCTCGAGAAGTTCAGGAGTCATTTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-206s1c1
Sequence:CCGGGCAGTTTGTGGTCAGATTCATCTCGAGATGAATCTGACCACAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-809s1c1
Sequence:CCGGAGGATATGTGAGGACGCAGATCTCGAGATCTGCGTCCTCACATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002120
HLA-DOB MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DO beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002120.3-990s21c1
Sequence:CCGGAGGACATTCATGAGGTCAATGCTCGAGCATTGACCTCATGAATGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002120.3-741s21c1
Sequence:CCGGGAGCTCAGTCTGAATATTCTTCTCGAGAAGAATATTCAGACTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-233s1c1
Sequence:CCGGCTTGGAGGAGTATGTACGTTTCTCGAGAAACGTACATACTCCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-615s1c1
Sequence:CCGGCTAGAAATGACTCCTGAACTTCTCGAGAAGTTCAGGAGTCATTTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-206s1c1
Sequence:CCGGGCAGTTTGTGGTCAGATTCATCTCGAGATGAATCTGACCACAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002120.2-809s1c1
Sequence:CCGGAGGATATGTGAGGACGCAGATCTCGAGATCTGCGTCCTCACATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)