EMAIL THIS PAGE TO A FRIEND

HLA-DPA1

major histocompatibility complex, class II, DP alpha 1

22 Gene Product Result for
Synonyms: DP(W3) DP(W4) HLA-DP1A HLADP HLASB PLT1
Gene ID:
Human(3113) Summary: HLA-DPA1 belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta (DPB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]
Zebrafish(553497) HLA-DPA1 protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033554 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112181 MISSION® esiRNA esiRNA human HLA-DPA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027116 predicted 302
2 SASI_Hs01_00027117 predicted 545
3 SASI_Hs01_00027118 predicted 552
4 SASI_Hs01_00027119 predicted 585
5 SASI_Hs01_00027120 predicted 256
6 SASI_Hs01_00027121 predicted 296
7 SASI_Hs01_00027122 predicted 544
8 SASI_Hs01_00027123 predicted 644
9 SASI_Hs01_00027124 predicted 300
10 SASI_Hs01_00027125 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033554
VALIDATED
HLA-DPA1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DP alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-301s1c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-553s1c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-140s1c1
Sequence:CCGGGTGTCAACTTATGCCGCGTTTCTCGAGAAACGCGGCATAAGTTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-301s21c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-131s1c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033554.2-759s1c1
Sequence:CCGGTCATCATAAAGTCTCTGCGTTCTCGAGAACGCAGAGACTTTATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-131s21c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-325s21c1
Sequence:CCGGCAACAACTTGAATACCTTGATCTCGAGATCAAGGTATTCAAGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033554.2-960s21c1
Sequence:CCGGAGCTCTGTCCTTATCCATTACCTCGAGGTAATGGATAAGGACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-553s21c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033554
VALIDATED
HLA-DPA1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DP alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-301s1c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-553s1c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-140s1c1
Sequence:CCGGGTGTCAACTTATGCCGCGTTTCTCGAGAAACGCGGCATAAGTTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-301s21c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-131s1c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033554.2-759s1c1
Sequence:CCGGTCATCATAAAGTCTCTGCGTTCTCGAGAACGCAGAGACTTTATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-131s21c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-325s21c1
Sequence:CCGGCAACAACTTGAATACCTTGATCTCGAGATCAAGGTATTCAAGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033554.2-960s21c1
Sequence:CCGGAGCTCTGTCCTTATCCATTACCTCGAGGTAATGGATAAGGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-553s21c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033554
VALIDATED
HLA-DPA1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DP alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-301s1c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-553s1c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-140s1c1
Sequence:CCGGGTGTCAACTTATGCCGCGTTTCTCGAGAAACGCGGCATAAGTTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-301s21c1
Sequence:CCGGGCTGGCTAACATTGCTATATTCTCGAGAATATAGCAATGTTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033554.2-131s1c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033554.2-759s1c1
Sequence:CCGGTCATCATAAAGTCTCTGCGTTCTCGAGAACGCAGAGACTTTATGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-131s21c1
Sequence:CCGGGCGGACCATGTGTCAACTTATCTCGAGATAAGTTGACACATGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-325s21c1
Sequence:CCGGCAACAACTTGAATACCTTGATCTCGAGATCAAGGTATTCAAGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033554.2-960s21c1
Sequence:CCGGAGCTCTGTCCTTATCCATTACCTCGAGGTAATGGATAAGGACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033554.2-553s21c1
Sequence:CCGGCAGCTTCCACAAGTTCCATTACTCGAGTAATGGAACTTGTGGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)