EMAIL THIS PAGE TO A FRIEND

HLA-DPB1

major histocompatibility complex, class II, DP beta 1

59 Gene Product Result for
Synonyms: DPB1 HLA-DP HLA-DP1B HLA-DPB
Species: Human HLA-DPB1(3115)
Gene ID:
Human(3115) Summary: HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002121 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002121 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199187 predicted 1251
2 SASI_Hs01_00199188 predicted 1035
3 SASI_Hs01_00199189 predicted 1064
4 SASI_Hs01_00199190 predicted 1245
5 SASI_Hs01_00199191 predicted 1143
6 SASI_Hs01_00199192 predicted 708
7 SASI_Hs01_00199186 predicted 1039
8 SASI_Hs01_00199193 predicted 987
9 SASI_Hs01_00199194 predicted 975
10 SASI_Hs01_00199195 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002121
HLA-DPB1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DP beta 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002121.4-1256s21c1
Sequence:CCGGTCTTCTGAATTGACTGTATTTCTCGAGAAATACAGTCAATTCAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002121.4-487s21c1
Sequence:CCGGTCTGCCACGTGACGGATTTCTCTCGAGAGAAATCCGTCACGTGGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-218s1c1
Sequence:CCGGCCTGGAGAGATACATCTACAACTCGAGTTGTAGATGTATCTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-150s1c1
Sequence:CCGGGCCACTCCAGAGAATTACCTTCTCGAGAAGGTAATTCTCTGGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-570s1c1
Sequence:CCGGTCCACCAACCTGATCCGTAATCTCGAGATTACGGATCAGGTTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-182s1c1
Sequence:CCGGGCAGGAATGCTACGCGTTTAACTCGAGTTAAACGCGTAGCATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-808s1c1
Sequence:CCGGGCAAGAAAGTTCAACGAGGATCTCGAGATCCTCGTTGAACTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002121
HLA-DPB1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DP beta 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002121.4-1256s21c1
Sequence:CCGGTCTTCTGAATTGACTGTATTTCTCGAGAAATACAGTCAATTCAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002121.4-487s21c1
Sequence:CCGGTCTGCCACGTGACGGATTTCTCTCGAGAGAAATCCGTCACGTGGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-218s1c1
Sequence:CCGGCCTGGAGAGATACATCTACAACTCGAGTTGTAGATGTATCTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-150s1c1
Sequence:CCGGGCCACTCCAGAGAATTACCTTCTCGAGAAGGTAATTCTCTGGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-570s1c1
Sequence:CCGGTCCACCAACCTGATCCGTAATCTCGAGATTACGGATCAGGTTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-182s1c1
Sequence:CCGGGCAGGAATGCTACGCGTTTAACTCGAGTTAAACGCGTAGCATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-808s1c1
Sequence:CCGGGCAAGAAAGTTCAACGAGGATCTCGAGATCCTCGTTGAACTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002121
HLA-DPB1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DP beta 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002121.4-1256s21c1
Sequence:CCGGTCTTCTGAATTGACTGTATTTCTCGAGAAATACAGTCAATTCAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002121.4-487s21c1
Sequence:CCGGTCTGCCACGTGACGGATTTCTCTCGAGAGAAATCCGTCACGTGGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-218s1c1
Sequence:CCGGCCTGGAGAGATACATCTACAACTCGAGTTGTAGATGTATCTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-150s1c1
Sequence:CCGGGCCACTCCAGAGAATTACCTTCTCGAGAAGGTAATTCTCTGGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-570s1c1
Sequence:CCGGTCCACCAACCTGATCCGTAATCTCGAGATTACGGATCAGGTTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-182s1c1
Sequence:CCGGGCAGGAATGCTACGCGTTTAACTCGAGTTAAACGCGTAGCATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002121.4-808s1c1
Sequence:CCGGGCAAGAAAGTTCAACGAGGATCTCGAGATCCTCGTTGAACTTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)