EMAIL THIS PAGE TO A FRIEND

HLA-DQA1

major histocompatibility complex, class II, DQ alpha 1

37 Gene Product Result for
Synonyms: CD CELIAC1 DQ-A1 GSE HLA-DQA
Species: Human HLA-DQA1(3117)
Gene ID:
Human(3117) Summary: HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111801 MISSION® esiRNA esiRNA human HLA-DQA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002122 Rosetta Predictions human pricing
XM_001722240 Rosetta Predictions human pricing
XM_001723439 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161326 predicted 327
2 SASI_Hs01_00161325 predicted 301
3 SASI_Hs01_00161327 predicted 1282
4 SASI_Hs01_00161328 predicted 795
5 SASI_Hs01_00161329 predicted 991
6 SASI_Hs01_00161330 predicted 1097
7 SASI_Hs01_00161332 predicted 988
8 SASI_Hs01_00161333 predicted 989
9 SASI_Hs01_00161334 predicted 928
10 SASI_Hs02_00333247 predicted 204
11 SASI_Hs01_00161331 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447969 predicted 301
2 SASI_Hs02_00447970 predicted 335
3 SASI_Hs02_00447971 predicted 294
4 SASI_Hs02_00447972 predicted 309
5 SASI_Hs02_00447973 predicted 898
6 SASI_Hs02_00447974 predicted 290
7 SASI_Hs02_00447975 predicted 937
8 SASI_Hs02_00447976 predicted 840
9 SASI_Hs02_00447977 predicted 830
10 SASI_Hs02_00447978 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455372 predicted 306
2 SASI_Hs02_00455373 predicted 328
3 SASI_Hs02_00455374 predicted 297
4 SASI_Hs02_00455375 predicted 312
5 SASI_Hs02_00455376 predicted 901
6 SASI_Hs02_00455377 predicted 297
7 SASI_Hs02_00455378 predicted 942
8 SASI_Hs02_00455379 predicted 840
9 SASI_Hs02_00455380 predicted 823
10 SASI_Hs02_00455381 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002122
HLA-DQA1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DQ alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002122.3-904s1c1
Sequence:CCGGGCCCGATTTATCATATCCCTTCTCGAGAAGGGATATGATAAATCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-333s1c1
Sequence:CCGGCACAACTTGAACATCATGATTCTCGAGAATCATGATGTTCAAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-263s1c1
Sequence:CCGGGTGGCCTGAGTTCAGCAAATTCTCGAGAATTTGCTGAACTCAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-143s1c1
Sequence:CCGGCGTTGCCTCTTGTGGTGTAAACTCGAGTTTACACCACAAGAGGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-506s21c1
Sequence:CCGGGCAGTCAGTCACAGAAGGTGTCTCGAGACACCTTCTGTGACTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-358s21c1
Sequence:CCGGGCTACAACTCTACCGCTGCTACTCGAGTAGCAGCGGTAGAGTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002122
HLA-DQA1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DQ alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002122.3-904s1c1
Sequence:CCGGGCCCGATTTATCATATCCCTTCTCGAGAAGGGATATGATAAATCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-333s1c1
Sequence:CCGGCACAACTTGAACATCATGATTCTCGAGAATCATGATGTTCAAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-263s1c1
Sequence:CCGGGTGGCCTGAGTTCAGCAAATTCTCGAGAATTTGCTGAACTCAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-143s1c1
Sequence:CCGGCGTTGCCTCTTGTGGTGTAAACTCGAGTTTACACCACAAGAGGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-506s21c1
Sequence:CCGGGCAGTCAGTCACAGAAGGTGTCTCGAGACACCTTCTGTGACTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-358s21c1
Sequence:CCGGGCTACAACTCTACCGCTGCTACTCGAGTAGCAGCGGTAGAGTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002122
HLA-DQA1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DQ alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002122.3-904s1c1
Sequence:CCGGGCCCGATTTATCATATCCCTTCTCGAGAAGGGATATGATAAATCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-333s1c1
Sequence:CCGGCACAACTTGAACATCATGATTCTCGAGAATCATGATGTTCAAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-263s1c1
Sequence:CCGGGTGGCCTGAGTTCAGCAAATTCTCGAGAATTTGCTGAACTCAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002122.3-143s1c1
Sequence:CCGGCGTTGCCTCTTGTGGTGTAAACTCGAGTTTACACCACAAGAGGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-506s21c1
Sequence:CCGGGCAGTCAGTCACAGAAGGTGTCTCGAGACACCTTCTGTGACTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002122.3-358s21c1
Sequence:CCGGGCTACAACTCTACCGCTGCTACTCGAGTAGCAGCGGTAGAGTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)