EMAIL THIS PAGE TO A FRIEND

HLA-DQA2

major histocompatibility complex, class II, DQ alpha 2

221 Gene Product Result for
Synonyms: DX-ALPHA HLA-DXA
Species: Human HLA-DQA2(3118)
UniProtKB ID: P01906, A2BF37, B0V0E7, O19789, Q5SQ94, Q5SR04
Gene ID:
Human(3118) Summary: This gene belongs to the HLA class II alpha chain family. The encoded protein forms a heterodimer with a class II beta chain. It is located in intracellular vesicles and plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (B lymphocytes, dendritic cells, macrophages) and are used to present antigenic peptides on the cell surface to be recognized by CD4 T-cells. [provided by RefSeq, Jun 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020056 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015239 predicted 342
2 SASI_Hs01_00015241 predicted 1090
3 SASI_Hs01_00015242 predicted 1071
4 SASI_Hs01_00015243 predicted 1091
5 SASI_Hs01_00015244 predicted 962
6 SASI_Hs01_00015245 predicted 929
7 SASI_Hs01_00015246 predicted 986
8 SASI_Hs01_00015240 predicted 813
9 SASI_Hs01_00015247 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020056
HLA-DQA2 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DQ alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-454s1c1
Sequence:CCGGCACTCAGTCACAGAAGGTGTTCTCGAGAACACCTTCTGTGACTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-498s1c1
Sequence:CCGGGAGTGATCATTCCTTCTTCAACTCGAGTTGAAGAAGGAATGATCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-208s1c1
Sequence:CCGGCAGTTGCCTATGTTTAGCAAACTCGAGTTTGCTAAACATAGGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-516s1c1
Sequence:CCGGCAAGATCAGTTACCTCACCTTCTCGAGAAGGTGAGGTAACTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-258s1c1
Sequence:CCGGGAGAAATATGGCTGTGGGAAACTCGAGTTTCCCACAGCCATATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-207s1c1
Sequence:CCGGGCAGTTGCCTATGTTTAGCAACTCGAGTTGCTAAACATAGGCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-70s1c1
Sequence:CCGGGAAGACATTGTGGCTGACCATCTCGAGATGGTCAGCCACAATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-334s1c1
Sequence:CCGGGTTCCTGAGGTCACAGTGTTTCTCGAGAAACACTGTGACCTCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-245s1c1
Sequence:CCGGCGCAGAGTGCACTGAGAAATACTCGAGTATTTCTCAGTGCACTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-390s1c1
Sequence:CCGGCCTCATCTGTCTTGTGGACAACTCGAGTTGTCCACAAGACAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020056
HLA-DQA2 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DQ alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-454s1c1
Sequence:CCGGCACTCAGTCACAGAAGGTGTTCTCGAGAACACCTTCTGTGACTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-498s1c1
Sequence:CCGGGAGTGATCATTCCTTCTTCAACTCGAGTTGAAGAAGGAATGATCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-208s1c1
Sequence:CCGGCAGTTGCCTATGTTTAGCAAACTCGAGTTTGCTAAACATAGGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-516s1c1
Sequence:CCGGCAAGATCAGTTACCTCACCTTCTCGAGAAGGTGAGGTAACTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-258s1c1
Sequence:CCGGGAGAAATATGGCTGTGGGAAACTCGAGTTTCCCACAGCCATATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-207s1c1
Sequence:CCGGGCAGTTGCCTATGTTTAGCAACTCGAGTTGCTAAACATAGGCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-70s1c1
Sequence:CCGGGAAGACATTGTGGCTGACCATCTCGAGATGGTCAGCCACAATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-334s1c1
Sequence:CCGGGTTCCTGAGGTCACAGTGTTTCTCGAGAAACACTGTGACCTCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-245s1c1
Sequence:CCGGCGCAGAGTGCACTGAGAAATACTCGAGTATTTCTCAGTGCACTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-390s1c1
Sequence:CCGGCCTCATCTGTCTTGTGGACAACTCGAGTTGTCCACAAGACAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020056
HLA-DQA2 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DQ alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-454s1c1
Sequence:CCGGCACTCAGTCACAGAAGGTGTTCTCGAGAACACCTTCTGTGACTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-498s1c1
Sequence:CCGGGAGTGATCATTCCTTCTTCAACTCGAGTTGAAGAAGGAATGATCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-208s1c1
Sequence:CCGGCAGTTGCCTATGTTTAGCAAACTCGAGTTTGCTAAACATAGGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-516s1c1
Sequence:CCGGCAAGATCAGTTACCTCACCTTCTCGAGAAGGTGAGGTAACTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-258s1c1
Sequence:CCGGGAGAAATATGGCTGTGGGAAACTCGAGTTTCCCACAGCCATATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-207s1c1
Sequence:CCGGGCAGTTGCCTATGTTTAGCAACTCGAGTTGCTAAACATAGGCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-70s1c1
Sequence:CCGGGAAGACATTGTGGCTGACCATCTCGAGATGGTCAGCCACAATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-334s1c1
Sequence:CCGGGTTCCTGAGGTCACAGTGTTTCTCGAGAAACACTGTGACCTCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-245s1c1
Sequence:CCGGCGCAGAGTGCACTGAGAAATACTCGAGTATTTCTCAGTGCACTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020056.1-390s1c1
Sequence:CCGGCCTCATCTGTCTTGTGGACAACTCGAGTTGTCCACAAGACAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)