EMAIL THIS PAGE TO A FRIEND

HLA-DQB1

major histocompatibility complex, class II, DQ beta 1

26 Gene Product Result for
Synonyms: CELIAC1 HLA-DQB IDDM1
Species: Human HLA-DQB1(3119)
Gene ID:
Human(3119) Summary: HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002123 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333248 predicted 821
2 SASI_Hs02_00333249 predicted 846
3 SASI_Hs02_00333250 predicted 841
4 SASI_Hs02_00333251 predicted 825
5 SASI_Hs02_00333252 predicted 444
6 SASI_Hs02_00333253 predicted 153
7 SASI_Hs01_00230717 predicted 252
8 SASI_Hs01_00230718 predicted 241
9 SASI_Hs01_00230719 predicted 242
10 SASI_Hs01_00230720 predicted 219
11 SASI_Hs01_00230721 predicted 213
12 SASI_Hs01_00230722 predicted 564
13 SASI_Hs01_00230723 predicted 229
14 SASI_Hs01_00230724 predicted 403
15 SASI_Hs01_00230725 predicted 233
16 SASI_Hs01_00230726 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002123
HLA-DQB1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DQ beta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-162s1c1
Sequence:CCGGCGAGGATTTCGTGTACCAGTTCTCGAGAACTGGTACACGAAATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-218s1c1
Sequence:CCGGGCGTGCGTCTTGTGAGCAGAACTCGAGTTCTGCTCACAAGACGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-235s1c1
Sequence:CCGGAGAAGCATCTATAACCGAGAACTCGAGTTCTCGGTTATAGATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-719s1c1
Sequence:CCGGCTCAATCTGAATCTGCCCAGACTCGAGTCTGGGCAGATTCAGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-804s1c1
Sequence:CCGGCATCCATCACAGGAGTCAGAACTCGAGTTCTGACTCCTGTGATGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002123
HLA-DQB1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DQ beta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-162s1c1
Sequence:CCGGCGAGGATTTCGTGTACCAGTTCTCGAGAACTGGTACACGAAATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-218s1c1
Sequence:CCGGGCGTGCGTCTTGTGAGCAGAACTCGAGTTCTGCTCACAAGACGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-235s1c1
Sequence:CCGGAGAAGCATCTATAACCGAGAACTCGAGTTCTCGGTTATAGATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-719s1c1
Sequence:CCGGCTCAATCTGAATCTGCCCAGACTCGAGTCTGGGCAGATTCAGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-804s1c1
Sequence:CCGGCATCCATCACAGGAGTCAGAACTCGAGTTCTGACTCCTGTGATGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002123
HLA-DQB1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DQ beta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-162s1c1
Sequence:CCGGCGAGGATTTCGTGTACCAGTTCTCGAGAACTGGTACACGAAATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-218s1c1
Sequence:CCGGGCGTGCGTCTTGTGAGCAGAACTCGAGTTCTGCTCACAAGACGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-235s1c1
Sequence:CCGGAGAAGCATCTATAACCGAGAACTCGAGTTCTCGGTTATAGATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-719s1c1
Sequence:CCGGCTCAATCTGAATCTGCCCAGACTCGAGTCTGGGCAGATTCAGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002123.2-804s1c1
Sequence:CCGGCATCCATCACAGGAGTCAGAACTCGAGTTCTGACTCCTGTGATGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)