EMAIL THIS PAGE TO A FRIEND

HLA-DQB2

major histocompatibility complex, class II, DQ beta 2

100 Gene Product Result for
Synonyms: HLA-DQB1 HLA-DXB
Species: Human HLA-DQB2(3120)
Gene ID:
Human(3120) Summary: HLA-DQB2 belongs to the family of HLA class II beta chain paralogs. Class II molecules are heterodimers consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. They play a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). Polymorphisms in the alpha and beta chains specify the peptide binding specificity, and typing for these polymorphisms is routinely done for bone marrow transplantation. However this gene, HLA-DQB2, is not routinely typed, as it is not thought to have an effect on transplantation. There is conflicting evidence in the literature and public sequence databases for the protein-coding capacity of HLA-DQB2. Because there is evidence of transcription and an intact ORF, HLA-DQB2 is represented in Entrez Gene and in RefSeq as a protein-coding locus. [provided by RefSeq, Oct 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182549 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148101 MISSION® esiRNA esiRNA human HLA-DQB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182549 Rosetta Predictions human pricing
NR_003937 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116280 predicted 518
2 SASI_Hs01_00116281 predicted 700
3 SASI_Hs01_00116282 predicted 704
4 SASI_Hs01_00116283 predicted 839
5 SASI_Hs01_00116284 predicted 527
6 SASI_Hs01_00116285 predicted 532
7 SASI_Hs01_00116286 predicted 728
8 SASI_Hs01_00116287 predicted 215
9 SASI_Hs01_00116288 predicted 348
10 SASI_Hs01_00116289 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380605 predicted 226
2 SASI_Hs02_00380606 predicted 756
3 SASI_Hs02_00380607 predicted 757
4 SASI_Hs02_00380608 predicted 888
5 SASI_Hs02_00380609 predicted 580
6 SASI_Hs02_00380610 predicted 583
7 SASI_Hs02_00380611 predicted 792
8 SASI_Hs02_00380612 predicted 340
9 SASI_Hs02_00380613 predicted 578
10 SASI_Hs02_00380614 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182549
HLA-DQB2 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DQ beta 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-182s1c1
Sequence:CCGGTGTGGCCAGATACATCTATAACTCGAGTTATAGATGTATCTGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-103s1c1
Sequence:CCGGCCAGAGACTTTCCCAAGGATTCTCGAGAATCCTTGGGAAAGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-284s1c1
Sequence:CCGGGAACAACTATAAGGACTTCTTCTCGAGAAGAAGTCCTTATAGTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-116s1c1
Sequence:CCGGCAAGGATTTCTTGGTCCAGTTCTCGAGAACTGGACCAAGAAATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-275s1c1
Sequence:CCGGCGAGGACTGGAACAACTATAACTCGAGTTATAGTTGTTCCAGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182549
HLA-DQB2 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DQ beta 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-182s1c1
Sequence:CCGGTGTGGCCAGATACATCTATAACTCGAGTTATAGATGTATCTGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-103s1c1
Sequence:CCGGCCAGAGACTTTCCCAAGGATTCTCGAGAATCCTTGGGAAAGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-284s1c1
Sequence:CCGGGAACAACTATAAGGACTTCTTCTCGAGAAGAAGTCCTTATAGTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-116s1c1
Sequence:CCGGCAAGGATTTCTTGGTCCAGTTCTCGAGAACTGGACCAAGAAATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-275s1c1
Sequence:CCGGCGAGGACTGGAACAACTATAACTCGAGTTATAGTTGTTCCAGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182549
HLA-DQB2 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DQ beta 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-182s1c1
Sequence:CCGGTGTGGCCAGATACATCTATAACTCGAGTTATAGATGTATCTGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-103s1c1
Sequence:CCGGCCAGAGACTTTCCCAAGGATTCTCGAGAATCCTTGGGAAAGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-284s1c1
Sequence:CCGGGAACAACTATAAGGACTTCTTCTCGAGAAGAAGTCCTTATAGTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-116s1c1
Sequence:CCGGCAAGGATTTCTTGGTCCAGTTCTCGAGAACTGGACCAAGAAATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182549.1-275s1c1
Sequence:CCGGCGAGGACTGGAACAACTATAACTCGAGTTATAGTTGTTCCAGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)