EMAIL THIS PAGE TO A FRIEND

HLA-DRA

major histocompatibility complex, class II, DR alpha

33 Gene Product Result for
Synonyms: HLA-DRA1 MLRW
Species: Human HLA-DRA(3122)
UniProtKB ID: P01903, A2BET4, Q30160, Q6IAZ1, Q861I2, Q9TP70
Gene ID:
Human(3122) Summary: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226621 MISSION® esiRNA esiRNA targeting human HLA-DRA human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019111 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048930 predicted 215
2 SASI_Hs01_00048931 predicted 284
3 SASI_Hs01_00048932 predicted 301
4 SASI_Hs01_00048934 predicted 288
5 SASI_Hs02_00352738 predicted 664
6 SASI_Hs01_00048935 predicted 200
7 SASI_Hs02_00352739 predicted 763
8 SASI_Hs01_00048936 predicted 329
9 SASI_Hs01_00048937 predicted 331
10 SASI_Hs01_00048938 predicted 906
11 SASI_Hs01_00048933 predicted 316
12 SASI_Hs01_00048939 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019111
HLA-DRA MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019111.3-909s1c1
Sequence:CCGGGCTTTACAAAGCTGGCAATATCTCGAGATATTGCCAGCTTTGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-181s1c1
Sequence:CCGGCAGGCCGAGTTCTATCTGAATCTCGAGATTCAGATAGAACTCGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-203s1c1
Sequence:CCGGCTGACCAATCAGGCGAGTTTACTCGAGTAAACTCGCCTGATTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-785s1c1
Sequence:CCGGCCATCTTCATCATCAAGGGATCTCGAGATCCCTTGATGATGAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019111.3-1010s21c1
Sequence:CCGGTCGATTGCTCCGTACTCTAACCTCGAGGTTAGAGTACGGAGCAATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019111.3-143s21c1
Sequence:CCGGAGGAATCATGGGCTATCAAAGCTCGAGCTTTGATAGCCCATGATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019111
HLA-DRA MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019111.3-909s1c1
Sequence:CCGGGCTTTACAAAGCTGGCAATATCTCGAGATATTGCCAGCTTTGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-181s1c1
Sequence:CCGGCAGGCCGAGTTCTATCTGAATCTCGAGATTCAGATAGAACTCGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-203s1c1
Sequence:CCGGCTGACCAATCAGGCGAGTTTACTCGAGTAAACTCGCCTGATTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-785s1c1
Sequence:CCGGCCATCTTCATCATCAAGGGATCTCGAGATCCCTTGATGATGAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019111.3-1010s21c1
Sequence:CCGGTCGATTGCTCCGTACTCTAACCTCGAGGTTAGAGTACGGAGCAATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019111.3-143s21c1
Sequence:CCGGAGGAATCATGGGCTATCAAAGCTCGAGCTTTGATAGCCCATGATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019111
HLA-DRA MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019111.3-909s1c1
Sequence:CCGGGCTTTACAAAGCTGGCAATATCTCGAGATATTGCCAGCTTTGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-181s1c1
Sequence:CCGGCAGGCCGAGTTCTATCTGAATCTCGAGATTCAGATAGAACTCGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-203s1c1
Sequence:CCGGCTGACCAATCAGGCGAGTTTACTCGAGTAAACTCGCCTGATTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019111.3-785s1c1
Sequence:CCGGCCATCTTCATCATCAAGGGATCTCGAGATCCCTTGATGATGAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019111.3-1010s21c1
Sequence:CCGGTCGATTGCTCCGTACTCTAACCTCGAGGTTAGAGTACGGAGCAATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019111.3-143s21c1
Sequence:CCGGAGGAATCATGGGCTATCAAAGCTCGAGCTTTGATAGCCCATGATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)