EMAIL THIS PAGE TO A FRIEND

HLA-DRB1

major histocompatibility complex, class II, DR beta 1

149 Gene Product Result for
Synonyms: DRB1 DRw10 HLA-DR1B HLA-DRB SS1
UniProtKB ID: Q30167, P01914, Q9MYF5
Gene ID:
Human(3123) Summary: HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogs DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
dog(474860) MHC class II DLA DRB1 beta chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002124 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085335 predicted 905
2 SASI_Hs01_00085336 predicted 904
3 SASI_Hs02_00333254 predicted 901
4 SASI_Hs01_00085334 predicted 914
5 SASI_Hs02_00333255 predicted 199
6 SASI_Hs01_00085339 predicted 823
7 SASI_Hs02_00333256 predicted 1104
8 SASI_Hs02_00333257 predicted 153
9 SASI_Hs02_00333258 predicted 72
10 SASI_Hs02_00333259 predicted 1077
11 SASI_Hs01_00085333 predicted 425
12 SASI_Hs01_00085337 predicted 223
13 SASI_Hs01_00085338 predicted 236
14 SASI_Hs01_00085340 predicted 878
15 SASI_Hs01_00085341 predicted 933
16 SASI_Hs01_00085342 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002124
HLA-DRB1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR beta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-209s21c1
Sequence:CCGGCTGGACAGATACTTCTATAACCTCGAGGTTATAGAAGTATCTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-159s21c1
Sequence:CCGGAGCCTAAGAGGGAGTGTCATTCTCGAGAATGACACTCCCTCTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-164s1c1
Sequence:CCGGACGTTTCTTGTGGCAGCTTAACTCGAGTTAAGCTGCCACAAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-177s1c1
Sequence:CCGGCAGCTTAAGTTTGAATGTCATCTCGAGATGACATTCAAACTTAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-248s1c1
Sequence:CCGGCCAAGAGGAGTCCGTGCGCTTCTCGAGAAGCGCACGGACTCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-227s1c1
Sequence:CCGGGCTGGAAAGATGCATCTATAACTCGAGTTATAGATGCATCTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-435s1c1
Sequence:CCGGGAGCCTAAGGTGACTGTGTATCTCGAGATACACAGTCACCTTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002124.2-956s21c1
Sequence:CCGGTTGCTACTGGTTCGGCAACTGCTCGAGCAGTTGCCGAACCAGTAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002124
HLA-DRB1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR beta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-209s21c1
Sequence:CCGGCTGGACAGATACTTCTATAACCTCGAGGTTATAGAAGTATCTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-159s21c1
Sequence:CCGGAGCCTAAGAGGGAGTGTCATTCTCGAGAATGACACTCCCTCTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-164s1c1
Sequence:CCGGACGTTTCTTGTGGCAGCTTAACTCGAGTTAAGCTGCCACAAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-177s1c1
Sequence:CCGGCAGCTTAAGTTTGAATGTCATCTCGAGATGACATTCAAACTTAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-248s1c1
Sequence:CCGGCCAAGAGGAGTCCGTGCGCTTCTCGAGAAGCGCACGGACTCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-227s1c1
Sequence:CCGGGCTGGAAAGATGCATCTATAACTCGAGTTATAGATGCATCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-435s1c1
Sequence:CCGGGAGCCTAAGGTGACTGTGTATCTCGAGATACACAGTCACCTTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002124.2-956s21c1
Sequence:CCGGTTGCTACTGGTTCGGCAACTGCTCGAGCAGTTGCCGAACCAGTAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002124
HLA-DRB1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR beta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-209s21c1
Sequence:CCGGCTGGACAGATACTTCTATAACCTCGAGGTTATAGAAGTATCTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002124.2-159s21c1
Sequence:CCGGAGCCTAAGAGGGAGTGTCATTCTCGAGAATGACACTCCCTCTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-164s1c1
Sequence:CCGGACGTTTCTTGTGGCAGCTTAACTCGAGTTAAGCTGCCACAAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-177s1c1
Sequence:CCGGCAGCTTAAGTTTGAATGTCATCTCGAGATGACATTCAAACTTAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-248s1c1
Sequence:CCGGCCAAGAGGAGTCCGTGCGCTTCTCGAGAAGCGCACGGACTCCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-227s1c1
Sequence:CCGGGCTGGAAAGATGCATCTATAACTCGAGTTATAGATGCATCTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002124.1-435s1c1
Sequence:CCGGGAGCCTAAGGTGACTGTGTATCTCGAGATACACAGTCACCTTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002124.2-956s21c1
Sequence:CCGGTTGCTACTGGTTCGGCAACTGCTCGAGCAGTTGCCGAACCAGTAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)