EMAIL THIS PAGE TO A FRIEND

HLA-DRB2

major histocompatibility complex, class II, DR beta 2 (pseudogene)

Gene Product Result for
Synonyms: HLA-DR2B
Species: Human HLA-DRB2(3124)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037638
HLA-DRB2 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR beta 2 (pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000154875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-796s1c1
Sequence:CCGGCAGAAAGGACACTCTGGACTTCTCGAGAAGTCCAGAGTGTCCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037638.1-852s1c1
Sequence:CCGGCCACATTCAAGGAAGAACTTTCTCGAGAAAGTTCTTCCTTGAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-204s1c1
Sequence:CCGGCCTGGACAGATACTTCTATAACTCGAGTTATAGAAGTATCTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-162s1c1
Sequence:CCGGGAGGGAGTGTCATTTCTTCAACTCGAGTTGAAGAAATGACACTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037638
HLA-DRB2 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR beta 2 (pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000154875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-796s1c1
Sequence:CCGGCAGAAAGGACACTCTGGACTTCTCGAGAAGTCCAGAGTGTCCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037638.1-852s1c1
Sequence:CCGGCCACATTCAAGGAAGAACTTTCTCGAGAAAGTTCTTCCTTGAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-204s1c1
Sequence:CCGGCCTGGACAGATACTTCTATAACTCGAGTTATAGAAGTATCTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-162s1c1
Sequence:CCGGGAGGGAGTGTCATTTCTTCAACTCGAGTTGAAGAAATGACACTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037638
HLA-DRB2 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR beta 2 (pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000154875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-796s1c1
Sequence:CCGGCAGAAAGGACACTCTGGACTTCTCGAGAAGTCCAGAGTGTCCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037638.1-852s1c1
Sequence:CCGGCCACATTCAAGGAAGAACTTTCTCGAGAAAGTTCTTCCTTGAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-204s1c1
Sequence:CCGGCCTGGACAGATACTTCTATAACTCGAGTTATAGAAGTATCTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037638.1-162s1c1
Sequence:CCGGGAGGGAGTGTCATTTCTTCAACTCGAGTTGAAGAAATGACACTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)