EMAIL THIS PAGE TO A FRIEND

HLA-DRB3

major histocompatibility complex, class II, DR beta 3

58 Gene Product Result for
Synonyms: HLA-DR3B
Species: Human HLA-DRB3(3125)
Gene ID:
Human(3125) Summary: HLA-DRB3 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB3 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022555 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153111 MISSION® esiRNA esiRNA human HLA-DRB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022555 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146802 predicted 909
2 SASI_Hs01_00146803 predicted 846
3 SASI_Hs01_00146804 predicted 925
4 SASI_Hs01_00146806 predicted 842
5 SASI_Hs01_00146808 predicted 895
6 SASI_Hs01_00146809 predicted 908
7 SASI_Hs01_00146805 predicted 834
8 SASI_Hs01_00146807 predicted 352
9 SASI_Hs01_00146811 predicted 200
10 SASI_Hs02_00355830 predicted 142
11 SASI_Hs01_00146810 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022555
HLA-DRB3 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR beta 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-157s1c1
Sequence:CCGGGCGTAAGTCTGAGTGTCATTTCTCGAGAAATGACACTCAGACTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-217s1c1
Sequence:CCGGCTTCCATAACCAGGAGGAGTTCTCGAGAACTCCTCCTGGTTATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-775s1c1
Sequence:CCGGGCTGTTCATCTACTTCAGGAACTCGAGTTCCTGAAGTAGATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-423s1c1
Sequence:CCGGTGACTGTGTATCCTGCAAAGACTCGAGTCTTTGCAGGATACACAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022555
HLA-DRB3 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR beta 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-157s1c1
Sequence:CCGGGCGTAAGTCTGAGTGTCATTTCTCGAGAAATGACACTCAGACTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-217s1c1
Sequence:CCGGCTTCCATAACCAGGAGGAGTTCTCGAGAACTCCTCCTGGTTATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-775s1c1
Sequence:CCGGGCTGTTCATCTACTTCAGGAACTCGAGTTCCTGAAGTAGATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-423s1c1
Sequence:CCGGTGACTGTGTATCCTGCAAAGACTCGAGTCTTTGCAGGATACACAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022555
HLA-DRB3 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR beta 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-157s1c1
Sequence:CCGGGCGTAAGTCTGAGTGTCATTTCTCGAGAAATGACACTCAGACTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-217s1c1
Sequence:CCGGCTTCCATAACCAGGAGGAGTTCTCGAGAACTCCTCCTGGTTATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-775s1c1
Sequence:CCGGGCTGTTCATCTACTTCAGGAACTCGAGTTCCTGAAGTAGATGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022555.3-423s1c1
Sequence:CCGGTGACTGTGTATCCTGCAAAGACTCGAGTCTTTGCAGGATACACAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)