EMAIL THIS PAGE TO A FRIEND

HLA-DRB4

major histocompatibility complex, class II, DR beta 4

50 Gene Product Result for
Synonyms: DR-4 DR4 DRB4 HLA-DR4B
Species: Human HLA-DRB4(3126)
Gene ID:
Human(3126) Summary: HLA-DRB4 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB4 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021983 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231021 MISSION® esiRNA esiRNA targeting human HLA-DRB4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021983 Rosetta Predictions human pricing
XM_001723414 Rosetta Predictions human pricing
XM_001723417 Rosetta Predictions human pricing
XM_001723419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039556 predicted 235
2 SASI_Hs01_00039558 predicted 257
3 SASI_Hs01_00039560 predicted 706
4 SASI_Hs01_00039561 predicted 928
5 SASI_Hs01_00039562 predicted 231
6 SASI_Hs02_00355350 predicted 1044
7 SASI_Hs02_00355351 predicted 166
8 SASI_Hs02_00355352 predicted 95
9 SASI_Hs02_00355353 predicted 167
10 SASI_Hs02_00355354 predicted 114
11 SASI_Hs01_00039555 predicted 505
12 SASI_Hs01_00039557 predicted 836
13 SASI_Hs01_00039559 predicted 873
14 SASI_Hs01_00039563 predicted 380
15 SASI_Hs01_00039564 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455238 predicted 961
2 SASI_Hs02_00455239 predicted 200
3 SASI_Hs02_00455240 predicted 217
4 SASI_Hs02_00455241 predicted 290
5 SASI_Hs02_00455242 predicted 205
6 SASI_Hs02_00455243 predicted 214
7 SASI_Hs02_00455244 predicted 220
8 SASI_Hs02_00455245 predicted 897
9 SASI_Hs02_00455246 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455247 predicted 953
2 SASI_Hs02_00455248 predicted 211
3 SASI_Hs02_00455249 predicted 285
4 SASI_Hs02_00455250 predicted 202
5 SASI_Hs02_00455251 predicted 215
6 SASI_Hs02_00455252 predicted 193
7 SASI_Hs02_00455253 predicted 217
8 SASI_Hs02_00455254 predicted 894
9 SASI_Hs02_00455255 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455256 predicted 929
2 SASI_Hs02_00455257 predicted 196
3 SASI_Hs02_00455258 predicted 217
4 SASI_Hs02_00455259 predicted 288
5 SASI_Hs02_00455260 predicted 200
6 SASI_Hs02_00455261 predicted 862
7 SASI_Hs02_00455262 predicted 215
8 SASI_Hs02_00455263 predicted 222
9 SASI_Hs02_00455264 predicted 870
10 SASI_Hs02_00455265 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021983
HLA-DRB4 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR beta 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021983.4-930s1c1
Sequence:CCGGGCTTTCCCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-800s1c1
Sequence:CCGGGACAGGGCTGTTCATCTACTTCTCGAGAAGTAGATGAACAGCCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-680s1c1
Sequence:CCGGAGTGGAGCATCCAAGCATGATCTCGAGATCATGCTTGGATGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-236s1c1
Sequence:CCGGCCTGATCAGATACATCTATAACTCGAGTTATAGATGTATCTGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-812s1c1
Sequence:CCGGCATCTACTTCAGGAATCAGAACTCGAGTTCTGATTCCTGAAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021983
HLA-DRB4 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR beta 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021983.4-930s1c1
Sequence:CCGGGCTTTCCCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-800s1c1
Sequence:CCGGGACAGGGCTGTTCATCTACTTCTCGAGAAGTAGATGAACAGCCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-680s1c1
Sequence:CCGGAGTGGAGCATCCAAGCATGATCTCGAGATCATGCTTGGATGCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-236s1c1
Sequence:CCGGCCTGATCAGATACATCTATAACTCGAGTTATAGATGTATCTGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-812s1c1
Sequence:CCGGCATCTACTTCAGGAATCAGAACTCGAGTTCTGATTCCTGAAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021983
HLA-DRB4 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR beta 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021983.4-930s1c1
Sequence:CCGGGCTTTCCCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-800s1c1
Sequence:CCGGGACAGGGCTGTTCATCTACTTCTCGAGAAGTAGATGAACAGCCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-680s1c1
Sequence:CCGGAGTGGAGCATCCAAGCATGATCTCGAGATCATGCTTGGATGCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-236s1c1
Sequence:CCGGCCTGATCAGATACATCTATAACTCGAGTTATAGATGTATCTGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021983.4-812s1c1
Sequence:CCGGCATCTACTTCAGGAATCAGAACTCGAGTTCTGATTCCTGAAGTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)