EMAIL THIS PAGE TO A FRIEND

HLA-DRB5

major histocompatibility complex, class II, DR beta 5

40 Gene Product Result for
Synonyms: HLA-DRB
Species: Human HLA-DRB5(3127)
Gene ID:
Human(3127) Summary: HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002125 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002125 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046608 predicted 368
2 SASI_Hs02_00333260 predicted 639
3 SASI_Hs01_00046614 predicted 943
4 SASI_Hs01_00046609 predicted 916
5 SASI_Hs02_00333261 predicted 1079
6 SASI_Hs02_00333262 predicted 1077
7 SASI_Hs02_00333263 predicted 1082
8 SASI_Hs02_00333264 predicted 115
9 SASI_Hs02_00333265 predicted 26
10 SASI_Hs02_00333266 predicted 105
11 SASI_Hs01_00046610 predicted 446
12 SASI_Hs01_00046611 predicted 930
13 SASI_Hs01_00046612 predicted 811
14 SASI_Hs01_00046613 predicted 769
15 SASI_Hs01_00046615 predicted 801
16 SASI_Hs01_00046616 predicted 883
17 SASI_Hs01_00046617 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002125
HLA-DRB5 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class II, DR beta 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-170s1c1
Sequence:CCGGCCTGCACAGAGACATCTATAACTCGAGTTATAGATGTCTCTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-564s1c1
Sequence:CCGGCTGGTGATGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCATCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-120s1c1
Sequence:CCGGCAGGATAAGTATGAGTGTCATCTCGAGATGACACTCATACTTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-737s1c1
Sequence:CCGGCGGGCTATTCATCTACTTCAACTCGAGTTGAAGTAGATGAATAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-283s1c1
Sequence:CCGGAGAAGGACTTCCTGGAAGACACTCGAGTGTCTTCCAGGAAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-196s21c1
Sequence:CCGGAGGAGGACTTGCGCTTCGACACTCGAGTGTCGAAGCGCAAGTCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-36s21c1
Sequence:CCGGTACATGGCAAAGCTGACAGTGCTCGAGCACTGTCAGCTTTGCCATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002125
HLA-DRB5 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class II, DR beta 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-170s1c1
Sequence:CCGGCCTGCACAGAGACATCTATAACTCGAGTTATAGATGTCTCTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-564s1c1
Sequence:CCGGCTGGTGATGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCATCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-120s1c1
Sequence:CCGGCAGGATAAGTATGAGTGTCATCTCGAGATGACACTCATACTTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-737s1c1
Sequence:CCGGCGGGCTATTCATCTACTTCAACTCGAGTTGAAGTAGATGAATAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-283s1c1
Sequence:CCGGAGAAGGACTTCCTGGAAGACACTCGAGTGTCTTCCAGGAAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-196s21c1
Sequence:CCGGAGGAGGACTTGCGCTTCGACACTCGAGTGTCGAAGCGCAAGTCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-36s21c1
Sequence:CCGGTACATGGCAAAGCTGACAGTGCTCGAGCACTGTCAGCTTTGCCATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002125
HLA-DRB5 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class II, DR beta 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-170s1c1
Sequence:CCGGCCTGCACAGAGACATCTATAACTCGAGTTATAGATGTCTCTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-564s1c1
Sequence:CCGGCTGGTGATGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCATCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-120s1c1
Sequence:CCGGCAGGATAAGTATGAGTGTCATCTCGAGATGACACTCATACTTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-737s1c1
Sequence:CCGGCGGGCTATTCATCTACTTCAACTCGAGTTGAAGTAGATGAATAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002125.3-283s1c1
Sequence:CCGGAGAAGGACTTCCTGGAAGACACTCGAGTGTCTTCCAGGAAGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-196s21c1
Sequence:CCGGAGGAGGACTTGCGCTTCGACACTCGAGTGTCGAAGCGCAAGTCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002125.3-36s21c1
Sequence:CCGGTACATGGCAAAGCTGACAGTGCTCGAGCACTGTCAGCTTTGCCATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)