EMAIL THIS PAGE TO A FRIEND

HLA-E

major histocompatibility complex, class I, E

27 Gene Product Result for
Synonyms: EA1.2 EA2.1 HLA-6.2 MHC QA1
Species: Human HLA-E(3133)
UniProtKB ID: P13747, Q30169, Q9BT83, Q9GIY7, Q9GIY8
Gene ID:
Human(3133) Summary: HLA-E belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-E binds a restricted subset of peptides derived from the leader peptides of other class I molecules. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Zinc Finger Nucleases

Product # Description Add to Cart
 
CKOZFN10143 CompoZr® Knockout ZFN Kit Human HLA-E (NM_005516) pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005516 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153375 predicted 1091
2 SASI_Hs01_00153376 predicted 976
3 SASI_Hs01_00153377 predicted 453
4 SASI_Hs01_00153378 predicted 1091
5 SASI_Hs01_00153381 predicted 972
6 SASI_Hs01_00153382 predicted 1316
7 SASI_Hs01_00153383 predicted 1262
8 SASI_Hs01_00153379 predicted 1109
9 SASI_Hs01_00153380 predicted 1105
10 SASI_Hs01_00153384 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005516
HLA-E MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, E
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1297s21c1
Sequence:CCGGCACCTCTGTGTCTACCATGACCTCGAGGTCATGGTAGACACAGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1338s21c1
Sequence:CCGGGTGTTCCTTCCCTGTTCTCTTCTCGAGAAGAGAACAGGGAAGGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-262s1c1
Sequence:CCGGGCCAGGGACACCGCACAGATTCTCGAGAATCTGTGCGGTGTCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-564s1c1
Sequence:CCGGGCTCCACAAATACCTGGAGAACTCGAGTTCTCCAGGTATTTGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-420s1c1
Sequence:CCGGCGGCAAGGATTATCTCACCCTCTCGAGAGGGTGAGATAATCCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-74s1c1
Sequence:CCGGCCTTGAAGTATTTCCACACTTCTCGAGAAGTGTGGAAATACTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005516
HLA-E MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, E
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1297s21c1
Sequence:CCGGCACCTCTGTGTCTACCATGACCTCGAGGTCATGGTAGACACAGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1338s21c1
Sequence:CCGGGTGTTCCTTCCCTGTTCTCTTCTCGAGAAGAGAACAGGGAAGGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-262s1c1
Sequence:CCGGGCCAGGGACACCGCACAGATTCTCGAGAATCTGTGCGGTGTCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-564s1c1
Sequence:CCGGGCTCCACAAATACCTGGAGAACTCGAGTTCTCCAGGTATTTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-420s1c1
Sequence:CCGGCGGCAAGGATTATCTCACCCTCTCGAGAGGGTGAGATAATCCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-74s1c1
Sequence:CCGGCCTTGAAGTATTTCCACACTTCTCGAGAAGTGTGGAAATACTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005516
HLA-E MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, E
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1297s21c1
Sequence:CCGGCACCTCTGTGTCTACCATGACCTCGAGGTCATGGTAGACACAGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005516.4-1338s21c1
Sequence:CCGGGTGTTCCTTCCCTGTTCTCTTCTCGAGAAGAGAACAGGGAAGGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-262s1c1
Sequence:CCGGGCCAGGGACACCGCACAGATTCTCGAGAATCTGTGCGGTGTCCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-564s1c1
Sequence:CCGGGCTCCACAAATACCTGGAGAACTCGAGTTCTCCAGGTATTTGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-420s1c1
Sequence:CCGGCGGCAAGGATTATCTCACCCTCTCGAGAGGGTGAGATAATCCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005516.3-74s1c1
Sequence:CCGGCCTTGAAGTATTTCCACACTTCTCGAGAAGTGTGGAAATACTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)