EMAIL THIS PAGE TO A FRIEND

HLA-F-AS1

HLA-F antisense RNA 1

27 Gene Product Result for
Species: Human HLA-F-AS1(285830)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003807 Rosetta Predictions human pricing
XR_039878 Rosetta Predictions human pricing
XR_039879 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238365 predicted 712
2 SASI_Hs01_00238366 predicted 392
3 SASI_Hs01_00238367 predicted 770
4 SASI_Hs01_00238368 predicted 457
5 SASI_Hs01_00238369 predicted 367
6 SASI_Hs01_00238370 predicted 851
7 SASI_Hs01_00238371 predicted 912
8 SASI_Hs01_00238372 predicted 706
9 SASI_Hs01_00238373 predicted 416
10 SASI_Hs01_00238374 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513862 predicted 428
2 SASI_Hs02_00513863 predicted 343
3 SASI_Hs02_00513864 predicted 323
4 SASI_Hs02_00513865 predicted 416
5 SASI_Hs02_00513866 predicted 331
6 SASI_Hs02_00513867 predicted 401
7 SASI_Hs02_00513868 predicted 377
8 SASI_Hs02_00513869 predicted 376
9 SASI_Hs02_00513870 predicted 391
10 SASI_Hs02_00513871 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513872 predicted 1159
2 SASI_Hs02_00513873 predicted 1164
3 SASI_Hs02_00513874 predicted 1133
4 SASI_Hs02_00513875 predicted 1217
5 SASI_Hs02_00513876 predicted 1184
6 SASI_Hs02_00513877 predicted 1176
7 SASI_Hs02_00513878 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003807
HLA-F-AS1 MISSION shRNA Bacterial Glycerol Stock
HLA-F antisense RNA 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-337s1c1
Sequence:CCGGGATCATATCAAGGGCCAGAAACTCGAGTTTCTGGCCCTTGATATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-419s1c1
Sequence:CCGGGAGACAGTATAACTCACCAGTCTCGAGACTGGTGAGTTATACTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2274s1c1
Sequence:CCGGCCAATGACAAACAGAGCATATCTCGAGATATGCTCTGTTTGTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-412s1c1
Sequence:CCGGGAAGAAAGAGACAGTATAACTCTCGAGAGTTATACTGTCTCTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-359s1c1
Sequence:CCGGGAGGAAGAGGAGATAAATATACTCGAGTATATTTATCTCCTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2799s1c1
Sequence:CCGGCCCATTGACTAATGAATGAATCTCGAGATTCATTCATTAGTCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-291s1c1
Sequence:CCGGGACTGAAGACTTGACAGAGAACTCGAGTTCTCTGTCAAGTCTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-354s1c1
Sequence:CCGGGAAAGGAGGAAGAGGAGATAACTCGAGTTATCTCCTCTTCCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2273s1c1
Sequence:CCGGGCCAATGACAAACAGAGCATACTCGAGTATGCTCTGTTTGTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-1294s1c1
Sequence:CCGGGCTGCTATTTACCTGAGTGTTCTCGAGAACACTCAGGTAAATAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003807
HLA-F-AS1 MISSION shRNA shRNA Plasmid DNA
HLA-F antisense RNA 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-337s1c1
Sequence:CCGGGATCATATCAAGGGCCAGAAACTCGAGTTTCTGGCCCTTGATATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-419s1c1
Sequence:CCGGGAGACAGTATAACTCACCAGTCTCGAGACTGGTGAGTTATACTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2274s1c1
Sequence:CCGGCCAATGACAAACAGAGCATATCTCGAGATATGCTCTGTTTGTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-412s1c1
Sequence:CCGGGAAGAAAGAGACAGTATAACTCTCGAGAGTTATACTGTCTCTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-359s1c1
Sequence:CCGGGAGGAAGAGGAGATAAATATACTCGAGTATATTTATCTCCTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2799s1c1
Sequence:CCGGCCCATTGACTAATGAATGAATCTCGAGATTCATTCATTAGTCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-291s1c1
Sequence:CCGGGACTGAAGACTTGACAGAGAACTCGAGTTCTCTGTCAAGTCTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-354s1c1
Sequence:CCGGGAAAGGAGGAAGAGGAGATAACTCGAGTTATCTCCTCTTCCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2273s1c1
Sequence:CCGGGCCAATGACAAACAGAGCATACTCGAGTATGCTCTGTTTGTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-1294s1c1
Sequence:CCGGGCTGCTATTTACCTGAGTGTTCTCGAGAACACTCAGGTAAATAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003807
HLA-F-AS1 MISSION shRNA Lentiviral Transduction Particles
HLA-F antisense RNA 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-337s1c1
Sequence:CCGGGATCATATCAAGGGCCAGAAACTCGAGTTTCTGGCCCTTGATATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-419s1c1
Sequence:CCGGGAGACAGTATAACTCACCAGTCTCGAGACTGGTGAGTTATACTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2274s1c1
Sequence:CCGGCCAATGACAAACAGAGCATATCTCGAGATATGCTCTGTTTGTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-412s1c1
Sequence:CCGGGAAGAAAGAGACAGTATAACTCTCGAGAGTTATACTGTCTCTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-359s1c1
Sequence:CCGGGAGGAAGAGGAGATAAATATACTCGAGTATATTTATCTCCTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2799s1c1
Sequence:CCGGCCCATTGACTAATGAATGAATCTCGAGATTCATTCATTAGTCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-291s1c1
Sequence:CCGGGACTGAAGACTTGACAGAGAACTCGAGTTCTCTGTCAAGTCTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003807.1-354s1c1
Sequence:CCGGGAAAGGAGGAAGAGGAGATAACTCGAGTTATCTCCTCTTCCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-2273s1c1
Sequence:CCGGGCCAATGACAAACAGAGCATACTCGAGTATGCTCTGTTTGTCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003807.1-1294s1c1
Sequence:CCGGGCTGCTATTTACCTGAGTGTTCTCGAGAACACTCAGGTAAATAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)