EMAIL THIS PAGE TO A FRIEND

HLA-F

major histocompatibility complex, class I, F

41 Gene Product Result for
Synonyms: CDA12 HLA-5.4 HLA-CDA12 HLAF
Species: Human HLA-F(3134)
Gene ID:
Human(3134) Summary: This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018950 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152921 MISSION® esiRNA esiRNA human HLA-F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098478 Rosetta Predictions human pricing
NM_001098479 Rosetta Predictions human pricing
NM_018950 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318949 predicted 272
2 SASI_Hs02_00318950 predicted 422
3 SASI_Hs02_00318951 predicted 466
4 SASI_Hs02_00318952 predicted 404
5 SASI_Hs02_00318953 predicted 239
6 SASI_Hs02_00318954 predicted 349
7 SASI_Hs02_00318955 predicted 377
8 SASI_Hs02_00318956 predicted 355
9 SASI_Hs02_00318957 predicted 365
10 SASI_Hs02_00318958 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318959 predicted 270
2 SASI_Hs02_00318960 predicted 416
3 SASI_Hs02_00318961 predicted 472
4 SASI_Hs02_00318962 predicted 407
5 SASI_Hs02_00318963 predicted 247
6 SASI_Hs02_00318964 predicted 349
7 SASI_Hs02_00318965 predicted 376
8 SASI_Hs02_00318966 predicted 354
9 SASI_Hs02_00318967 predicted 365
10 SASI_Hs02_00318968 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352416 predicted 269
2 SASI_Hs01_00013542 predicted 422
3 SASI_Hs02_00352417 predicted 474
4 SASI_Hs02_00352418 predicted 406
5 SASI_Hs02_00352419 predicted 248
6 SASI_Hs02_00352420 predicted 354
7 SASI_Hs01_00013547 predicted 373
8 SASI_Hs01_00013549 predicted 358
9 SASI_Hs02_00352421 predicted 361
10 SASI_Hs02_00352422 predicted 242
11 SASI_Hs01_00013541 predicted 342
12 SASI_Hs01_00013543 predicted 611
13 SASI_Hs01_00013544 predicted 918
14 SASI_Hs01_00013545 predicted 534
15 SASI_Hs01_00013546 predicted 724
16 SASI_Hs01_00013548 predicted 839
17 SASI_Hs01_00013550 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018950
VALIDATED
HLA-F MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, F
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-1002s1c1
Sequence:CCGGAGATAGAAACAGAGGGAGCTACTCGAGTAGCTCCCTCTGTTTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-233s1c1
Sequence:CCGGCGCAGTATTGGGAGTGGACCACTCGAGTGGTCCACTCCCAATACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-139s1c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-510s1c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-348s1c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-472s21c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-634s21c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018950.2-690s21c1
Sequence:CCGGTCCGCAGATACTTGGAGAATGCTCGAGCATTCTCCAAGTATCTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-263s21c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018950
VALIDATED
HLA-F MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, F
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-1002s1c1
Sequence:CCGGAGATAGAAACAGAGGGAGCTACTCGAGTAGCTCCCTCTGTTTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-233s1c1
Sequence:CCGGCGCAGTATTGGGAGTGGACCACTCGAGTGGTCCACTCCCAATACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-139s1c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-510s1c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-348s1c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-472s21c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-634s21c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018950.2-690s21c1
Sequence:CCGGTCCGCAGATACTTGGAGAATGCTCGAGCATTCTCCAAGTATCTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-263s21c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018950
VALIDATED
HLA-F MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, F
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-1002s1c1
Sequence:CCGGAGATAGAAACAGAGGGAGCTACTCGAGTAGCTCCCTCTGTTTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-233s1c1
Sequence:CCGGCGCAGTATTGGGAGTGGACCACTCGAGTGGTCCACTCCCAATACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-139s1c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018950.1-510s1c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018950.1-348s1c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-472s21c1
Sequence:CCGGCCAGGGAATGAATGGCTGCGACTCGAGTCGCAGCCATTCATTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-634s21c1
Sequence:CCGGAGAGGAATATGCAGAGGAGTTCTCGAGAACTCCTCTGCATATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018950.2-690s21c1
Sequence:CCGGTCCGCAGATACTTGGAGAATGCTCGAGCATTCTCCAAGTATCTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018950.2-263s21c1
Sequence:CCGGGAGTACGTAGACGACACGCAACTCGAGTTGCGTGTCGTCTACGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)