EMAIL THIS PAGE TO A FRIEND

HLA-G

major histocompatibility complex, class I, G

119 Gene Product Result for
Synonyms: MHC-G
Species: Human HLA-G(3135)
UniProtKB ID: P17693
Gene ID:
Human(3135) Summary: HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702386 Anti-HLA-G antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2702383 Anti-HLA-G [N1C3] antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4700323 Monoclonal Anti-HLA-G , (C-terminal) antibody produced in mouse clone 5A6G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700308 Monoclonal Anti-HLA-G antibody produced in mouse clone G233, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700310 Monoclonal Anti-HLA-G antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700311 Monoclonal Anti-HLA-G antibody produced in mouse clone 01G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700318 Monoclonal Anti-HLA-G antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700320 Monoclonal Anti-HLA-G antibody produced in mouse clone MEM-G/11, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700309 Monoclonal Anti-HLA-G azide free antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700304 Monoclonal Anti-HLA-G, low endotoxin antibody produced in mouse clone 87G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700312 Monoclonal Anti-HLA-G-APC antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700324 Monoclonal Anti-HLA-G-Biotin , (C-terminal) antibody produced in mouse clone 5A6G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700305 Monoclonal Anti-HLA-G-Biotin antibody produced in mouse clone 87G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700313 Monoclonal Anti-HLA-G-Biotin antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700306 Monoclonal Anti-HLA-G-FITC antibody produced in mouse clone 87G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700315 Monoclonal Anti-HLA-G-FITC antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700316 Monoclonal Anti-HLA-G-FITC antibody produced in mouse clone 01G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700319 Monoclonal Anti-HLA-G-FITC antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700321 Monoclonal Anti-HLA-G-FITC antibody produced in mouse clone MEM-G/11, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700325 Monoclonal Anti-HLA-G-PE , (C-terminal) antibody produced in mouse clone 5A6G7, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700307 Monoclonal Anti-HLA-G-PE antibody produced in mouse clone 87G, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700317 Monoclonal Anti-HLA-G-PE antibody produced in mouse clone MEM-G/9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002127 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146742 predicted 467
2 SASI_Hs01_00146745 predicted 582
3 SASI_Hs01_00146748 predicted 440
4 SASI_Hs01_00146749 predicted 687
5 SASI_Hs02_00333268 predicted 586
6 SASI_Hs02_00333269 predicted 1276
7 SASI_Hs02_00333270 predicted 695
8 SASI_Hs02_00333271 predicted 512
9 SASI_Hs02_00333272 predicted 1502
10 SASI_Hs02_00333273 predicted 1432
11 SASI_Hs01_00146743 predicted 1161
12 SASI_Hs01_00146744 predicted 1439
13 SASI_Hs01_00146746 predicted 1170
14 SASI_Hs01_00146747 predicted 1384
15 SASI_Hs01_00146750 predicted 1170
16 SASI_Hs01_00146751 predicted 1240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002127
HLA-G MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, G
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-748s1c1
Sequence:CCGGCCACCCTGTCTTTGACTATGACTCGAGTCATAGTCAAAGACAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-391s1c1
Sequence:CCGGGACTGACAGAATGAACCTGCACTCGAGTGCAGGTTCATTCTGTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-621s1c1
Sequence:CCGGCGGCCAATGTGGCTGAACAAACTCGAGTTTGTTCAGCCACATTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-512s1c1
Sequence:CCGGTATGAACAGTATGCCTACGATCTCGAGATCGTAGGCATACTGTTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-1046s1c1
Sequence:CCGGCTGGTTGTCCTTGCAGCTGTACTCGAGTACAGCTGCAAGGACAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002127.5-662s21c1
Sequence:CCGGACTGCGGCTCAGATCTCCAAGCTCGAGCTTGGAGATCTGAGCCGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002127.5-1248s21c1
Sequence:CCGGACTGAGTGGCAAGTCCCTTTGCTCGAGCAAAGGGACTTGCCACTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002127
HLA-G MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, G
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-748s1c1
Sequence:CCGGCCACCCTGTCTTTGACTATGACTCGAGTCATAGTCAAAGACAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-391s1c1
Sequence:CCGGGACTGACAGAATGAACCTGCACTCGAGTGCAGGTTCATTCTGTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-621s1c1
Sequence:CCGGCGGCCAATGTGGCTGAACAAACTCGAGTTTGTTCAGCCACATTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-512s1c1
Sequence:CCGGTATGAACAGTATGCCTACGATCTCGAGATCGTAGGCATACTGTTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-1046s1c1
Sequence:CCGGCTGGTTGTCCTTGCAGCTGTACTCGAGTACAGCTGCAAGGACAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002127.5-662s21c1
Sequence:CCGGACTGCGGCTCAGATCTCCAAGCTCGAGCTTGGAGATCTGAGCCGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002127.5-1248s21c1
Sequence:CCGGACTGAGTGGCAAGTCCCTTTGCTCGAGCAAAGGGACTTGCCACTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002127
HLA-G MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, G
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-748s1c1
Sequence:CCGGCCACCCTGTCTTTGACTATGACTCGAGTCATAGTCAAAGACAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-391s1c1
Sequence:CCGGGACTGACAGAATGAACCTGCACTCGAGTGCAGGTTCATTCTGTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-621s1c1
Sequence:CCGGCGGCCAATGTGGCTGAACAAACTCGAGTTTGTTCAGCCACATTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-512s1c1
Sequence:CCGGTATGAACAGTATGCCTACGATCTCGAGATCGTAGGCATACTGTTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002127.3-1046s1c1
Sequence:CCGGCTGGTTGTCCTTGCAGCTGTACTCGAGTACAGCTGCAAGGACAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002127.5-662s21c1
Sequence:CCGGACTGCGGCTCAGATCTCCAAGCTCGAGCTTGGAGATCTGAGCCGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002127.5-1248s21c1
Sequence:CCGGACTGAGTGGCAAGTCCCTTTGCTCGAGCAAAGGGACTTGCCACTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)