EMAIL THIS PAGE TO A FRIEND

HLCS

holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)

135 Gene Product Result for
Synonyms: HCS
UniProtKB ID: P50747, D3DSG6, Q99451
Gene ID:
Human(3141) Summary: This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Mouse(110948) holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Rat(288240) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Zebrafish(337784) holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)
cow(534247) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Horse(100061132) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
domestic cat(101100992) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
dog(478412) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
chicken(418516) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
sheep(101109588) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
domestic guinea pig(100716230) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
naked mole-rat(101722847) holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000411 Rosetta Predictions human pricing
XM_001054618 Rosetta Predictions rat pricing
XM_221630 Rosetta Predictions rat pricing
NM_139145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237366 predicted 2221
2 SASI_Hs01_00237367 predicted 776
3 SASI_Hs01_00237368 predicted 1574
4 SASI_Hs01_00237369 predicted 542
5 SASI_Hs01_00237370 predicted 1742
6 SASI_Hs01_00237371 predicted 2113
7 SASI_Hs01_00237372 predicted 2247
8 SASI_Hs01_00237373 predicted 1508
9 SASI_Hs01_00237374 predicted 1907
10 SASI_Hs01_00237375 predicted 2124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276527 predicted 1630
2 SASI_Rn02_00276528 predicted 2333
3 SASI_Rn02_00276529 predicted 1657
4 SASI_Rn02_00276530 predicted 998
5 SASI_Rn02_00276531 predicted 2232
6 SASI_Rn02_00276532 predicted 3097
7 SASI_Rn02_00276533 predicted 2836
8 SASI_Rn02_00276534 predicted 2516
9 SASI_Rn02_00276535 predicted 2968
10 SASI_Rn02_00276536 predicted 2851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380231 predicted 2292
2 SASI_Rn02_00380232 predicted 2186
3 SASI_Rn02_00380233 predicted 3047
4 SASI_Rn02_00380234 predicted 2789
5 SASI_Rn02_00380235 predicted 2466
6 SASI_Rn02_00380236 predicted 3159
7 SASI_Rn02_00380237 predicted 2916
8 SASI_Rn02_00380238 predicted 2800
9 SASI_Rn02_00380239 predicted 2156
10 SASI_Rn02_00380240 predicted 2531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102414 predicted 2214
2 SASI_Mm01_00102415 predicted 1913
3 SASI_Mm01_00102416 predicted 624
4 SASI_Mm01_00102417 predicted 218
5 SASI_Mm01_00102418 predicted 664
6 SASI_Mm01_00102419 predicted 1222
7 SASI_Mm01_00102420 predicted 1855
8 SASI_Mm01_00102421 predicted 1632
9 SASI_Mm01_00102422 predicted 1636
10 SASI_Mm01_00102423 predicted 1514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000411
VALIDATED
HLCS MISSION shRNA Bacterial Glycerol Stock
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-5025s21c1
Sequence:CCGGCATTGAGTATCGACCGTATTTCTCGAGAAATACGGTCGATACTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-824s21c1
Sequence:CCGGCAGACCTTCCCTACGATTATACTCGAGTATAATCGTAGGGAAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000411.4-2111s21c1
Sequence:CCGGAGTATCAGGATATCAACTTACCTCGAGGTAAGTTGATATCCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-2135s21c1
Sequence:CCGGTGAAGTGGCCCAACGATATTTCTCGAGAAATATCGTTGGGCCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-1448s21c1
Sequence:CCGGTACCTCCCAGCTCCAACATAGCTCGAGCTATGTTGGAGCTGGGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1906s1c1
Sequence:CCGGCCGCAGGAAATGGGCTTAATACTCGAGTATTAAGCCCATTTCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-570s1c1
Sequence:CCGGGCCTGAACCTTCTCTTGAGATCTCGAGATCTCAAGAGAAGGTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1712s1c1
Sequence:CCGGCCTACGTGTCTGAAGTAGAAACTCGAGTTTCTACTTCAGACACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000411.4-833s1c1
Sequence:CCGGCCTACGATTATAGCAGCAGTTCTCGAGAACTGCTGCTATAATCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-2234s1c1
Sequence:CCGGGCTGTGGATTTAATGTGACTACTCGAGTAGTCACATTAAATCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000411
VALIDATED
HLCS MISSION shRNA shRNA Plasmid DNA
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-5025s21c1
Sequence:CCGGCATTGAGTATCGACCGTATTTCTCGAGAAATACGGTCGATACTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-824s21c1
Sequence:CCGGCAGACCTTCCCTACGATTATACTCGAGTATAATCGTAGGGAAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000411.4-2111s21c1
Sequence:CCGGAGTATCAGGATATCAACTTACCTCGAGGTAAGTTGATATCCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-2135s21c1
Sequence:CCGGTGAAGTGGCCCAACGATATTTCTCGAGAAATATCGTTGGGCCACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-1448s21c1
Sequence:CCGGTACCTCCCAGCTCCAACATAGCTCGAGCTATGTTGGAGCTGGGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1906s1c1
Sequence:CCGGCCGCAGGAAATGGGCTTAATACTCGAGTATTAAGCCCATTTCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-570s1c1
Sequence:CCGGGCCTGAACCTTCTCTTGAGATCTCGAGATCTCAAGAGAAGGTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1712s1c1
Sequence:CCGGCCTACGTGTCTGAAGTAGAAACTCGAGTTTCTACTTCAGACACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000411.4-833s1c1
Sequence:CCGGCCTACGATTATAGCAGCAGTTCTCGAGAACTGCTGCTATAATCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-2234s1c1
Sequence:CCGGGCTGTGGATTTAATGTGACTACTCGAGTAGTCACATTAAATCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000411
VALIDATED
HLCS MISSION shRNA Lentiviral Transduction Particles
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-5025s21c1
Sequence:CCGGCATTGAGTATCGACCGTATTTCTCGAGAAATACGGTCGATACTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-824s21c1
Sequence:CCGGCAGACCTTCCCTACGATTATACTCGAGTATAATCGTAGGGAAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000411.4-2111s21c1
Sequence:CCGGAGTATCAGGATATCAACTTACCTCGAGGTAAGTTGATATCCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-2135s21c1
Sequence:CCGGTGAAGTGGCCCAACGATATTTCTCGAGAAATATCGTTGGGCCACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000411.4-1448s21c1
Sequence:CCGGTACCTCCCAGCTCCAACATAGCTCGAGCTATGTTGGAGCTGGGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1906s1c1
Sequence:CCGGCCGCAGGAAATGGGCTTAATACTCGAGTATTAAGCCCATTTCCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-570s1c1
Sequence:CCGGGCCTGAACCTTCTCTTGAGATCTCGAGATCTCAAGAGAAGGTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-1712s1c1
Sequence:CCGGCCTACGTGTCTGAAGTAGAAACTCGAGTTTCTACTTCAGACACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000411.4-833s1c1
Sequence:CCGGCCTACGATTATAGCAGCAGTTCTCGAGAACTGCTGCTATAATCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000411.4-2234s1c1
Sequence:CCGGGCTGTGGATTTAATGTGACTACTCGAGTAGTCACATTAAATCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139145
HLCS MISSION shRNA Bacterial Glycerol Stock
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-655s1c2
Sequence:CCGGGCGCCCAATATCTTGCTGTATCTCGAGATACAGCAAGATATTGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1632s1c2
Sequence:CCGGGCCGCAGGAAATGGGCTTAATCTCGAGATTAAGCCCATTTCCTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139145.2-2745s1c1
Sequence:CCGGGCGCTGAGATAGTACAAATATCTCGAGATATTTGTACTATCTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1979s1c1
Sequence:CCGGCGAACAGTAATCCTACCATTTCTCGAGAAATGGTAGGATTACTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-2215s1c1
Sequence:CCGGGCATCTATTGTGGGCCTTGATCTCGAGATCAAGGCCCACAATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139145
HLCS MISSION shRNA shRNA Plasmid DNA
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-655s1c2
Sequence:CCGGGCGCCCAATATCTTGCTGTATCTCGAGATACAGCAAGATATTGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1632s1c2
Sequence:CCGGGCCGCAGGAAATGGGCTTAATCTCGAGATTAAGCCCATTTCCTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139145.2-2745s1c1
Sequence:CCGGGCGCTGAGATAGTACAAATATCTCGAGATATTTGTACTATCTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1979s1c1
Sequence:CCGGCGAACAGTAATCCTACCATTTCTCGAGAAATGGTAGGATTACTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-2215s1c1
Sequence:CCGGGCATCTATTGTGGGCCTTGATCTCGAGATCAAGGCCCACAATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139145
HLCS MISSION shRNA Lentiviral Transduction Particles
holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-655s1c2
Sequence:CCGGGCGCCCAATATCTTGCTGTATCTCGAGATACAGCAAGATATTGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1632s1c2
Sequence:CCGGGCCGCAGGAAATGGGCTTAATCTCGAGATTAAGCCCATTTCCTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139145.2-2745s1c1
Sequence:CCGGGCGCTGAGATAGTACAAATATCTCGAGATATTTGTACTATCTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-1979s1c1
Sequence:CCGGCGAACAGTAATCCTACCATTTCTCGAGAAATGGTAGGATTACTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139145.2-2215s1c1
Sequence:CCGGGCATCTATTGTGGGCCTTGATCTCGAGATCAAGGCCCACAATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)