EMAIL THIS PAGE TO A FRIEND

HLF

hepatic leukemia factor

234 Gene Product Result for
UniProtKB ID: Q16534
Gene ID:
Human(3131) Summary: This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(217082) hepatic leukemia factor
Rat(363667) hepatic leukemia factor
sheep(100192429) hepatic leukemia factor
domestic guinea pig(100724740) hepatic leukemia factor
naked mole-rat(101702600) hepatic leukemia factor
chicken(417395) hepatic leukemia factor
dog(609564) hepatic leukemia factor
cow(516069) hepatic leukemia factor
domestic cat(101085586) hepatic leukemia factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002126 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU059601 MISSION® esiRNA esiRNA targeting mouse Hlf (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002126 Rosetta Predictions human pricing
XM_001081149 Rosetta Predictions rat pricing
XM_343956 Rosetta Predictions rat pricing
NM_172563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093684 predicted 973
2 SASI_Hs01_00093685 predicted 1863
3 SASI_Hs01_00093686 predicted 1889
4 SASI_Hs01_00093687 predicted 620
5 SASI_Hs02_00333267 predicted 931
6 SASI_Hs01_00093688 predicted 624
7 SASI_Hs01_00093689 predicted 741
8 SASI_Hs01_00093690 predicted 756
9 SASI_Hs01_00093691 predicted 1878
10 SASI_Hs01_00093692 predicted 997
11 SASI_Hs01_00093693 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370745 predicted 1132
2 SASI_Rn02_00370746 predicted 1116
3 SASI_Rn02_00370747 predicted 703
4 SASI_Rn02_00370748 predicted 1069
5 SASI_Rn02_00370749 predicted 931
6 SASI_Rn02_00370750 predicted 837
7 SASI_Rn02_00370751 predicted 710
8 SASI_Rn02_00370752 predicted 1117
9 SASI_Rn02_00370753 predicted 699
10 SASI_Rn02_00370754 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174083 predicted 287
2 SASI_Rn01_00174084 predicted 442
3 SASI_Rn01_00174085 predicted 469
4 SASI_Rn01_00174086 predicted 533
5 SASI_Rn01_00174087 predicted 406
6 SASI_Rn01_00174088 predicted 421
7 SASI_Rn01_00174089 predicted 362
8 SASI_Rn01_00174090 predicted 516
9 SASI_Rn01_00174091 predicted 550
10 SASI_Rn01_00174092 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103403 predicted 655
2 SASI_Mm01_00103404 predicted 1057
3 SASI_Mm01_00103405 predicted 1193
4 SASI_Mm01_00103406 predicted 1005
5 SASI_Mm01_00103408 predicted 770
6 SASI_Mm02_00344203 predicted 1203
7 SASI_Mm02_00344204 predicted 805
8 SASI_Mm02_00344205 predicted 1055
9 SASI_Mm02_00344206 predicted 1032
10 SASI_Mm02_00344207 predicted 1276
11 SASI_Mm01_00103407 predicted 1005
12 SASI_Mm01_00103409 predicted 761
13 SASI_Mm01_00103410 predicted 799
14 SASI_Mm01_00103411 predicted 1890
15 SASI_Mm01_00103412 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172563
HLF MISSION shRNA Bacterial Glycerol Stock
hepatic leukemia factor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1191s1c1
Sequence:CCGGCGATGATTTGAAGGATGACAACTCGAGTTGTCATCCTTCAAATCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1174s1c1
Sequence:CCGGCGCAAAGTCTTCATTCCCGATCTCGAGATCGGGAATGAAGACTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-774s1c1
Sequence:CCGGCCAGCTGGAATACATGGACTTCTCGAGAAGTCCATGTATTCCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172563.2-2129s1c1
Sequence:CCGGCCCAGATAAGTAAGTACCATTCTCGAGAATGGTACTTACTTATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1149s1c1
Sequence:CCGGGCCACAGCCCATGATTAAGAACTCGAGTTCTTAATCATGGGCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1678s21c1
Sequence:CCGGCCTTCACACTTGTCGTTTAAACTCGAGTTTAAACGACAAGTGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1648s21c1
Sequence:CCGGTGCATGTGTGAGCGTGTATATCTCGAGATATACACGCTCACACATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172563
HLF MISSION shRNA shRNA Plasmid DNA
hepatic leukemia factor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1191s1c1
Sequence:CCGGCGATGATTTGAAGGATGACAACTCGAGTTGTCATCCTTCAAATCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1174s1c1
Sequence:CCGGCGCAAAGTCTTCATTCCCGATCTCGAGATCGGGAATGAAGACTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-774s1c1
Sequence:CCGGCCAGCTGGAATACATGGACTTCTCGAGAAGTCCATGTATTCCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172563.2-2129s1c1
Sequence:CCGGCCCAGATAAGTAAGTACCATTCTCGAGAATGGTACTTACTTATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1149s1c1
Sequence:CCGGGCCACAGCCCATGATTAAGAACTCGAGTTCTTAATCATGGGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1678s21c1
Sequence:CCGGCCTTCACACTTGTCGTTTAAACTCGAGTTTAAACGACAAGTGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1648s21c1
Sequence:CCGGTGCATGTGTGAGCGTGTATATCTCGAGATATACACGCTCACACATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172563
HLF MISSION shRNA Lentiviral Transduction Particles
hepatic leukemia factor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1191s1c1
Sequence:CCGGCGATGATTTGAAGGATGACAACTCGAGTTGTCATCCTTCAAATCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1174s1c1
Sequence:CCGGCGCAAAGTCTTCATTCCCGATCTCGAGATCGGGAATGAAGACTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-774s1c1
Sequence:CCGGCCAGCTGGAATACATGGACTTCTCGAGAAGTCCATGTATTCCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172563.2-2129s1c1
Sequence:CCGGCCCAGATAAGTAAGTACCATTCTCGAGAATGGTACTTACTTATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172563.2-1149s1c1
Sequence:CCGGGCCACAGCCCATGATTAAGAACTCGAGTTCTTAATCATGGGCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1678s21c1
Sequence:CCGGCCTTCACACTTGTCGTTTAAACTCGAGTTTAAACGACAAGTGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172563.3-1648s21c1
Sequence:CCGGTGCATGTGTGAGCGTGTATATCTCGAGATATACACGCTCACACATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002126
HLF MISSION shRNA Bacterial Glycerol Stock
hepatic leukemia factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002126.3-3326s1c1
Sequence:CCGGCGGTGCTATGTGTTTGGTTTACTCGAGTAAACCAAACACATAGCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1050s1c1
Sequence:CCGGGAAATGTTTGACCCTCGCAAACTCGAGTTTGCGAGGGTCAAACATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1310s1c1
Sequence:CCGGGCTGGGCAAATGCAAGAACATCTCGAGATGTTCTTGCATTTGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-697s1c1
Sequence:CCGGCCCTTCCCTATGACGGAGATACTCGAGTATCTCCGTCATAGGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-588s1c1
Sequence:CCGGGAAGACGCATTTAGTAAAGATCTCGAGATCTTTACTAAATGCGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002126
HLF MISSION shRNA shRNA Plasmid DNA
hepatic leukemia factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002126.3-3326s1c1
Sequence:CCGGCGGTGCTATGTGTTTGGTTTACTCGAGTAAACCAAACACATAGCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1050s1c1
Sequence:CCGGGAAATGTTTGACCCTCGCAAACTCGAGTTTGCGAGGGTCAAACATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1310s1c1
Sequence:CCGGGCTGGGCAAATGCAAGAACATCTCGAGATGTTCTTGCATTTGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-697s1c1
Sequence:CCGGCCCTTCCCTATGACGGAGATACTCGAGTATCTCCGTCATAGGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-588s1c1
Sequence:CCGGGAAGACGCATTTAGTAAAGATCTCGAGATCTTTACTAAATGCGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002126
HLF MISSION shRNA Lentiviral Transduction Particles
hepatic leukemia factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002126.3-3326s1c1
Sequence:CCGGCGGTGCTATGTGTTTGGTTTACTCGAGTAAACCAAACACATAGCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1050s1c1
Sequence:CCGGGAAATGTTTGACCCTCGCAAACTCGAGTTTGCGAGGGTCAAACATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-1310s1c1
Sequence:CCGGGCTGGGCAAATGCAAGAACATCTCGAGATGTTCTTGCATTTGCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-697s1c1
Sequence:CCGGCCCTTCCCTATGACGGAGATACTCGAGTATCTCCGTCATAGGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002126.3-588s1c1
Sequence:CCGGGAAGACGCATTTAGTAAAGATCTCGAGATCTTTACTAAATGCGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)