EMAIL THIS PAGE TO A FRIEND

HLTF

helicase-like transcription factor

188 Gene Product Result for
Synonyms: HIP116 HIP116A HLTF1 RNF80 SMARCA3 SNF2L3 ZBU1
Gene ID:
Human(6596) Summary: This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
Mouse(20585) helicase-like transcription factor
Rat(295568) helicase-like transcription factor
Zebrafish(564651) helicase-like transcription factor
dog(477106) helicase-like transcription factor
domestic cat(101081918) helicase-like transcription factor
cow(539633) helicase-like transcription factor
Horse(100058775) helicase-like transcription factor
sheep(101122911) helicase-like transcription factor
Domestic Rabbit(100009232) helicase-like transcription factor
domestic guinea pig(100716292) helicase-like transcription factor
naked mole-rat(101719751) helicase-like transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003071 Rosetta Predictions human pricing
NM_139048 Rosetta Predictions human pricing
NM_001106478 Rosetta Predictions rat pricing
NM_009210 Rosetta Predictions mouse pricing
NM_144959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162286 predicted 1631
2 SASI_Hs01_00162287 predicted 2696
3 SASI_Hs01_00162288 predicted 2490
4 SASI_Hs01_00162289 predicted 2343
5 SASI_Hs01_00162290 predicted 2366
6 SASI_Hs01_00162291 predicted 958
7 SASI_Hs01_00162292 predicted 2600
8 SASI_Hs01_00162293 predicted 263
9 SASI_Hs01_00162294 predicted 2837
10 SASI_Hs02_00334990 predicted 1145
11 SASI_Hs01_00162295 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029458 predicted 1639
2 SASI_Hs01_00029461 predicted 2345
3 SASI_Hs02_00364101 predicted 2178
4 SASI_Hs02_00364102 predicted 1843
5 SASI_Hs01_00029462 predicted 2361
6 SASI_Hs01_00029463 predicted 956
7 SASI_Hs01_00029464 predicted 2598
8 SASI_Hs01_00029465 predicted 265
9 SASI_Hs01_00029466 predicted 2837
10 SASI_Hs02_00364103 predicted 1860
11 SASI_Hs01_00029459 predicted 2672
12 SASI_Hs01_00029460 predicted 2470
13 SASI_Hs01_00029467 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219358 predicted 2458
2 SASI_Rn02_00219359 predicted 1257
3 SASI_Rn02_00219360 predicted 1082
4 SASI_Rn02_00219361 predicted 326
5 SASI_Rn02_00219362 predicted 1897
6 SASI_Rn02_00219363 predicted 1799
7 SASI_Rn02_00219364 predicted 1699
8 SASI_Rn02_00219365 predicted 2296
9 SASI_Rn02_00219366 predicted 1882
10 SASI_Rn02_00219367 predicted 1828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315600 predicted 1909
2 SASI_Mm02_00315601 predicted 1774
3 SASI_Mm02_00315602 predicted 674
4 SASI_Mm02_00315603 predicted 1886
5 SASI_Mm02_00315604 predicted 1978
6 SASI_Mm02_00315605 predicted 1798
7 SASI_Mm02_00315606 predicted 383
8 SASI_Mm02_00315607 predicted 489
9 SASI_Mm02_00315608 predicted 433
10 SASI_Mm02_00315609 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073536 predicted 1910
2 SASI_Mm01_00073537 predicted 1780
3 SASI_Mm01_00073538 predicted 672
4 SASI_Mm01_00073539 predicted 1892
5 SASI_Mm01_00073540 predicted 1977
6 SASI_Mm01_00073541 predicted 1799
7 SASI_Mm01_00073542 predicted 386
8 SASI_Mm01_00073543 predicted 484
9 SASI_Mm01_00073544 predicted 438
10 SASI_Mm01_00073545 predicted 1259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009210
VALIDATED
HLTF MISSION shRNA Bacterial Glycerol Stock
helicase-like transcription factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-1836s21c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-973s21c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-430s21c1
Sequence:CCGGTTACAACGAGAGCCTAATAATCTCGAGATTATTAGGCTCTCGTTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-3580s21c1
Sequence:CCGGCAAGTATATACAGACTATAAGCTCGAGCTTATAGTCTGTATATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009210.1-264s1c1
Sequence:CCGGGCCTAATAATCCCTATGATAACTCGAGTTATCATAGGGATTATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-2358s1c1
Sequence:CCGGGCCACATGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-212s1c1
Sequence:CCGGGCTATTACACAGGAGTTGTAACTCGAGTTACAACTCCTGTGTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-1659s1c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-796s1c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009210
VALIDATED
HLTF MISSION shRNA shRNA Plasmid DNA
helicase-like transcription factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-1836s21c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-973s21c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-430s21c1
Sequence:CCGGTTACAACGAGAGCCTAATAATCTCGAGATTATTAGGCTCTCGTTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-3580s21c1
Sequence:CCGGCAAGTATATACAGACTATAAGCTCGAGCTTATAGTCTGTATATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009210.1-264s1c1
Sequence:CCGGGCCTAATAATCCCTATGATAACTCGAGTTATCATAGGGATTATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-2358s1c1
Sequence:CCGGGCCACATGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-212s1c1
Sequence:CCGGGCTATTACACAGGAGTTGTAACTCGAGTTACAACTCCTGTGTAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-1659s1c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-796s1c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009210
VALIDATED
HLTF MISSION shRNA Lentiviral Transduction Particles
helicase-like transcription factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-1836s21c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-973s21c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009210.2-430s21c1
Sequence:CCGGTTACAACGAGAGCCTAATAATCTCGAGATTATTAGGCTCTCGTTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009210.2-3580s21c1
Sequence:CCGGCAAGTATATACAGACTATAAGCTCGAGCTTATAGTCTGTATATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009210.1-264s1c1
Sequence:CCGGGCCTAATAATCCCTATGATAACTCGAGTTATCATAGGGATTATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-2358s1c1
Sequence:CCGGGCCACATGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-212s1c1
Sequence:CCGGGCTATTACACAGGAGTTGTAACTCGAGTTACAACTCCTGTGTAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-1659s1c1
Sequence:CCGGCCATGCCATTCGAAATCCAAACTCGAGTTTGGATTTCGAATGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009210.1-796s1c1
Sequence:CCGGCAGCGCAATGACTTATATTATCTCGAGATAATATAAGTCATTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003071
VALIDATED
HLTF MISSION shRNA Bacterial Glycerol Stock
helicase-like transcription factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-2958s21c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-3933s21c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-416s21c1
Sequence:CCGGTGTGGTTGGACTACGCTATTACTCGAGTAATAGCGTAGTCCAACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1015s21c1
Sequence:CCGGAGCGAAATGACTTATACTATACTCGAGTATAGTATAAGTCATTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1758s21c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-2934s1c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-2341s1c1
Sequence:CCGGGTTGCCATACTTACCTTCTTACTCGAGTAAGAAGGTAAGTATGGCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-3050s1c1
Sequence:CCGGGCAAGAAGTTATCATCACAAACTCGAGTTTGTGATGATAACTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-1734s1c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-3909s1c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003071
VALIDATED
HLTF MISSION shRNA shRNA Plasmid DNA
helicase-like transcription factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-2958s21c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-3933s21c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-416s21c1
Sequence:CCGGTGTGGTTGGACTACGCTATTACTCGAGTAATAGCGTAGTCCAACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1015s21c1
Sequence:CCGGAGCGAAATGACTTATACTATACTCGAGTATAGTATAAGTCATTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1758s21c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-2934s1c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-2341s1c1
Sequence:CCGGGTTGCCATACTTACCTTCTTACTCGAGTAAGAAGGTAAGTATGGCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-3050s1c1
Sequence:CCGGGCAAGAAGTTATCATCACAAACTCGAGTTTGTGATGATAACTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-1734s1c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-3909s1c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003071
VALIDATED
HLTF MISSION shRNA Lentiviral Transduction Particles
helicase-like transcription factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-2958s21c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-3933s21c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-416s21c1
Sequence:CCGGTGTGGTTGGACTACGCTATTACTCGAGTAATAGCGTAGTCCAACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1015s21c1
Sequence:CCGGAGCGAAATGACTTATACTATACTCGAGTATAGTATAAGTCATTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003071.3-1758s21c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-2934s1c1
Sequence:CCGGGCAGGTGGAGTTGGTTTGAATCTCGAGATTCAAACCAACTCCACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-2341s1c1
Sequence:CCGGGTTGCCATACTTACCTTCTTACTCGAGTAAGAAGGTAAGTATGGCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003071.x-3050s1c1
Sequence:CCGGGCAAGAAGTTATCATCACAAACTCGAGTTTGTGATGATAACTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-1734s1c1
Sequence:CCGGCGTATTAGAGAACCGGCCTTACTCGAGTAAGGCCGGTTCTCTAATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003071.x-3909s1c1
Sequence:CCGGGCTGTGTCTGAGGTATAAATACTCGAGTATTTATACCTCAGACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)