EMAIL THIS PAGE TO A FRIEND

HLX

H2.0-like homeobox

67 Gene Product Result for
Synonyms: HB24 HLX1
UniProtKB ID: Q14774, B2R8A8, Q15988, Q59HE7, Q9NZ75
Gene ID:
Mouse(15284) H2.0-like homeobox
Rat(364069) H2.0-like homeobox
domestic cat(101100028) H2.0-like homeobox
dog(100682869) H2.0-like homeobox
cow(519165) H2.0-like homeobox
domestic guinea pig(100715435) H2.0-like homeobox
naked mole-rat(101714618) H2.0-like homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021958 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021958 Rosetta Predictions human pricing
NM_001077674 Rosetta Predictions rat pricing
NM_008250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212171 predicted 1182
2 SASI_Hs01_00212172 predicted 576
3 SASI_Hs01_00212173 predicted 1113
4 SASI_Hs01_00212174 predicted 580
5 SASI_Hs01_00212175 predicted 1125
6 SASI_Hs01_00212176 predicted 1210
7 SASI_Hs01_00212177 predicted 1337
8 SASI_Hs01_00212178 predicted 1112
9 SASI_Hs01_00212179 predicted 585
10 SASI_Hs01_00212180 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207862 predicted 1722
2 SASI_Rn02_00207863 predicted 903
3 SASI_Rn02_00207864 predicted 827
4 SASI_Rn02_00207865 predicted 1695
5 SASI_Rn02_00207866 predicted 1732
6 SASI_Rn02_00207867 predicted 338
7 SASI_Rn02_00207868 predicted 1790
8 SASI_Rn02_00207869 predicted 1342
9 SASI_Rn02_00207870 predicted 1294
10 SASI_Rn02_00207871 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040472 predicted 1216
2 SASI_Mm01_00040473 predicted 1033
3 SASI_Mm01_00040474 predicted 1338
4 SASI_Mm01_00040475 predicted 1646
5 SASI_Mm01_00040476 predicted 480
6 SASI_Mm01_00040477 predicted 484
7 SASI_Mm01_00040478 predicted 979
8 SASI_Mm01_00040479 predicted 1125
9 SASI_Mm01_00040481 predicted 586
10 SASI_Mm02_00313445 predicted 1621
11 SASI_Mm01_00040480 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008250
VALIDATED
HLX MISSION shRNA Bacterial Glycerol Stock
H2.0-like homeobox
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-581s1c1
Sequence:CCGGCTGTCAAGAAACCCTCTTTCTCTCGAGAGAAAGAGGGTTTCTTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1659s1c1
Sequence:CCGGGCATCAAACCACGGTCATCAACTCGAGTTGATGACCGTGGTTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-1193s1c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-964s1c1
Sequence:CCGGCCCTCCAGCAAAGACCTCAAACTCGAGTTTGAGGTCTTTGCTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1005s1c1
Sequence:CCGGGTCTGCGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008250.2-1824s21c1
Sequence:CCGGCTGGACTTTGTGCCTACTTTACTCGAGTAAAGTAGGCACAAAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1328s21c1
Sequence:CCGGATGAAGTGGCGGCACTCTAAGCTCGAGCTTAGAGTGCCGCCACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1014s21c1
Sequence:CCGGTCGCATCTCTAGATCCCATTACTCGAGTAATGGGATCTAGAGATGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1118s21c1
Sequence:CCGGCCCTATGCTGTGCTCACTAAGCTCGAGCTTAGTGAGCACAGCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1077s21c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008250
VALIDATED
HLX MISSION shRNA shRNA Plasmid DNA
H2.0-like homeobox
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-581s1c1
Sequence:CCGGCTGTCAAGAAACCCTCTTTCTCTCGAGAGAAAGAGGGTTTCTTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1659s1c1
Sequence:CCGGGCATCAAACCACGGTCATCAACTCGAGTTGATGACCGTGGTTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-1193s1c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-964s1c1
Sequence:CCGGCCCTCCAGCAAAGACCTCAAACTCGAGTTTGAGGTCTTTGCTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1005s1c1
Sequence:CCGGGTCTGCGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008250.2-1824s21c1
Sequence:CCGGCTGGACTTTGTGCCTACTTTACTCGAGTAAAGTAGGCACAAAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1328s21c1
Sequence:CCGGATGAAGTGGCGGCACTCTAAGCTCGAGCTTAGAGTGCCGCCACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1014s21c1
Sequence:CCGGTCGCATCTCTAGATCCCATTACTCGAGTAATGGGATCTAGAGATGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1118s21c1
Sequence:CCGGCCCTATGCTGTGCTCACTAAGCTCGAGCTTAGTGAGCACAGCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1077s21c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008250
VALIDATED
HLX MISSION shRNA Lentiviral Transduction Particles
H2.0-like homeobox
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-581s1c1
Sequence:CCGGCTGTCAAGAAACCCTCTTTCTCTCGAGAGAAAGAGGGTTTCTTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1659s1c1
Sequence:CCGGGCATCAAACCACGGTCATCAACTCGAGTTGATGACCGTGGTTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-1193s1c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008250.1-964s1c1
Sequence:CCGGCCCTCCAGCAAAGACCTCAAACTCGAGTTTGAGGTCTTTGCTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008250.1-1005s1c1
Sequence:CCGGGTCTGCGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008250.2-1824s21c1
Sequence:CCGGCTGGACTTTGTGCCTACTTTACTCGAGTAAAGTAGGCACAAAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1328s21c1
Sequence:CCGGATGAAGTGGCGGCACTCTAAGCTCGAGCTTAGAGTGCCGCCACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008250.2-1014s21c1
Sequence:CCGGTCGCATCTCTAGATCCCATTACTCGAGTAATGGGATCTAGAGATGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1118s21c1
Sequence:CCGGCCCTATGCTGTGCTCACTAAGCTCGAGCTTAGTGAGCACAGCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008250.2-1077s21c1
Sequence:CCGGGAAATTCTGTTCAGCATCAATCTCGAGATTGATGCTGAACAGAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021958
HLX MISSION shRNA Bacterial Glycerol Stock
H2.0-like homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-948s1c1
Sequence:CCGGCCTCCAGCAAAGACCTCAAATCTCGAGATTTGAGGTCTTTGCTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021958.2-1975s1c1
Sequence:CCGGGCTTACTGTATGTTGGCGACTCTCGAGAGTCGCCAACATACAGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1645s1c1
Sequence:CCGGGCACCAAACAACAGTTATTAACTCGAGTTAATAACTGTTGTTTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1114s1c1
Sequence:CCGGCGCATCTCTAGATCCCATTAACTCGAGTTAATGGGATCTAGAGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1172s1c1
Sequence:CCGGCCAAGAAATTCAGTTCAGCATCTCGAGATGCTGAACTGAATTTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1038s21c1
Sequence:CCGGACACGCTGAGAGATCTCACTTCTCGAGAAGTGAGATCTCTCAGCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1218s21c1
Sequence:CCGGACACGTTTCCAGGTCCCTATGCTCGAGCATAGGGACCTGGAAACGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021958
HLX MISSION shRNA shRNA Plasmid DNA
H2.0-like homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-948s1c1
Sequence:CCGGCCTCCAGCAAAGACCTCAAATCTCGAGATTTGAGGTCTTTGCTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021958.2-1975s1c1
Sequence:CCGGGCTTACTGTATGTTGGCGACTCTCGAGAGTCGCCAACATACAGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1645s1c1
Sequence:CCGGGCACCAAACAACAGTTATTAACTCGAGTTAATAACTGTTGTTTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1114s1c1
Sequence:CCGGCGCATCTCTAGATCCCATTAACTCGAGTTAATGGGATCTAGAGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1172s1c1
Sequence:CCGGCCAAGAAATTCAGTTCAGCATCTCGAGATGCTGAACTGAATTTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1038s21c1
Sequence:CCGGACACGCTGAGAGATCTCACTTCTCGAGAAGTGAGATCTCTCAGCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1218s21c1
Sequence:CCGGACACGTTTCCAGGTCCCTATGCTCGAGCATAGGGACCTGGAAACGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021958
HLX MISSION shRNA Lentiviral Transduction Particles
H2.0-like homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-948s1c1
Sequence:CCGGCCTCCAGCAAAGACCTCAAATCTCGAGATTTGAGGTCTTTGCTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021958.2-1975s1c1
Sequence:CCGGGCTTACTGTATGTTGGCGACTCTCGAGAGTCGCCAACATACAGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1645s1c1
Sequence:CCGGGCACCAAACAACAGTTATTAACTCGAGTTAATAACTGTTGTTTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1114s1c1
Sequence:CCGGCGCATCTCTAGATCCCATTAACTCGAGTTAATGGGATCTAGAGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021958.2-1172s1c1
Sequence:CCGGCCAAGAAATTCAGTTCAGCATCTCGAGATGCTGAACTGAATTTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1038s21c1
Sequence:CCGGACACGCTGAGAGATCTCACTTCTCGAGAAGTGAGATCTCTCAGCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021958.3-1218s21c1
Sequence:CCGGACACGTTTCCAGGTCCCTATGCTCGAGCATAGGGACCTGGAAACGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)