EMAIL THIS PAGE TO A FRIEND

HM13

histocompatibility (minor) 13

98 Gene Product Result for
Synonyms: H13 IMP1 IMPAS IMPAS-1 MSTP086 PSENL3 PSL3 SPP SPPL1 dJ324O17.1
Gene ID:
Human(81502) Summary: The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(311545) histocompatibility 13
sheep(101111384) histocompatibility (minor) 13
Domestic Rabbit(100348554) histocompatibility (minor) 13
domestic guinea pig(100712676) histocompatibility (minor) 13
naked mole-rat(101715311) histocompatibility (minor) 13
Zebrafish(259190) histocompatibility (minor) 13
chicken(100859573) histocompatibility (minor) 13
domestic cat(101097309) histocompatibility (minor) 13
cow(512534) histocompatibility (minor) 13
Horse(100053502) histocompatibility (minor) 13
dog(608355) histocompatibility (minor) 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030789 Rosetta Predictions human pricing
NM_178580 Rosetta Predictions human pricing
NM_178581 Rosetta Predictions human pricing
NM_178582 Rosetta Predictions human pricing
NM_001107789 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100621 predicted 807
2 SASI_Hs01_00100622 predicted 816
3 SASI_Hs01_00100623 predicted 523
4 SASI_Hs01_00100625 predicted 615
5 SASI_Hs02_00358338 predicted 678
6 SASI_Hs01_00100626 predicted 287
7 SASI_Hs01_00100627 predicted 585
8 SASI_Hs01_00100628 predicted 293
9 SASI_Hs01_00100629 predicted 775
10 SASI_Hs01_00100630 predicted 648
11 SASI_Hs01_00100624 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197907 predicted 806
2 SASI_Hs01_00197908 predicted 809
3 SASI_Hs01_00197909 predicted 523
4 SASI_Hs01_00197911 predicted 622
5 SASI_Hs02_00369832 predicted 683
6 SASI_Hs01_00197912 predicted 286
7 SASI_Hs01_00197913 predicted 588
8 SASI_Hs01_00197914 predicted 293
9 SASI_Hs01_00197915 predicted 774
10 SASI_Hs01_00197916 predicted 650
11 SASI_Hs01_00197910 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141964 predicted 807
2 SASI_Hs01_00141965 predicted 808
3 SASI_Hs01_00141966 predicted 524
4 SASI_Hs01_00141968 predicted 616
5 SASI_Hs02_00369833 predicted 681
6 SASI_Hs01_00141969 predicted 287
7 SASI_Hs01_00141970 predicted 586
8 SASI_Hs01_00141971 predicted 298
9 SASI_Hs01_00141972 predicted 767
10 SASI_Hs01_00141973 predicted 648
11 SASI_Hs01_00141967 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109145 predicted 277
2 SASI_Hs01_00109146 predicted 284
3 SASI_Hs01_00109147 predicted 298
4 SASI_Hs01_00109149 predicted 304
5 SASI_Hs01_00109150 predicted 292
6 SASI_Hs01_00109151 predicted 279
7 SASI_Hs01_00109152 predicted 284
8 SASI_Hs01_00109153 predicted 279
9 SASI_Hs01_00109154 predicted 297
10 SASI_Hs02_00369834 predicted 700
11 SASI_Hs01_00109148 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232285 predicted 942
2 SASI_Rn02_00232286 predicted 972
3 SASI_Rn02_00232287 predicted 729
4 SASI_Rn02_00232288 predicted 288
5 SASI_Rn02_00232289 predicted 856
6 SASI_Rn02_00232290 predicted 807
7 SASI_Rn02_00232291 predicted 615
8 SASI_Rn02_00232292 predicted 748
9 SASI_Rn02_00232293 predicted 746
10 SASI_Rn02_00232294 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030789
VALIDATED
HM13 MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-816s21c1
Sequence:CCGGGTCCTTCGAGGCACCAATAAACTCGAGTTTATTGGTGCCTCGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-945s21c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-753s21c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-301s21c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-1398s1c1
Sequence:CCGGCCTCTGTTTCCTTCTCCCTTTCTCGAGAAAGGGAGAAGGAAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-753s1c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-301s1c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-945s1c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-873s1c1
Sequence:CCGGCGAAGCAAACAACTTTGCCATCTCGAGATGGCAAAGTTGTTTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030789.2-1270s21c1
Sequence:CCGGTCAGGGCCAGACCAGACAGATCTCGAGATCTGTCTGGTCTGGCCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030789
VALIDATED
HM13 MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-816s21c1
Sequence:CCGGGTCCTTCGAGGCACCAATAAACTCGAGTTTATTGGTGCCTCGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-945s21c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-753s21c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-301s21c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-1398s1c1
Sequence:CCGGCCTCTGTTTCCTTCTCCCTTTCTCGAGAAAGGGAGAAGGAAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-753s1c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-301s1c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-945s1c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-873s1c1
Sequence:CCGGCGAAGCAAACAACTTTGCCATCTCGAGATGGCAAAGTTGTTTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030789.2-1270s21c1
Sequence:CCGGTCAGGGCCAGACCAGACAGATCTCGAGATCTGTCTGGTCTGGCCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030789
VALIDATED
HM13 MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-816s21c1
Sequence:CCGGGTCCTTCGAGGCACCAATAAACTCGAGTTTATTGGTGCCTCGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-945s21c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-753s21c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030789.2-301s21c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-1398s1c1
Sequence:CCGGCCTCTGTTTCCTTCTCCCTTTCTCGAGAAAGGGAGAAGGAAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030789.2-753s1c1
Sequence:CCGGCGGACTCTTCATCTACGATGTCTCGAGACATCGTAGATGAAGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-301s1c1
Sequence:CCGGGCTTCAGACATGCCTGAAACACTCGAGTGTTTCAGGCATGTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-945s1c1
Sequence:CCGGGCGCTTTGACATCAGCTTGAACTCGAGTTCAAGCTGATGTCAAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030789.2-873s1c1
Sequence:CCGGCGAAGCAAACAACTTTGCCATCTCGAGATGGCAAAGTTGTTTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030789.2-1270s21c1
Sequence:CCGGTCAGGGCCAGACCAGACAGATCTCGAGATCTGTCTGGTCTGGCCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)