EMAIL THIS PAGE TO A FRIEND

HMBOX1

homeobox containing 1

130 Gene Product Result for
Synonyms: HNF1LA HOT1 PBHNF
Gene ID:
Mouse(219150) homeobox containing 1
Rat(305968) homeobox containing 1
chicken(422024) homeobox containing 1
dog(486089) homeobox containing 1
cow(539099) homeobox containing 1
Horse(100054823) homeobox containing 1
domestic cat(101081540) homeobox containing 1
sheep(101116706) homeobox containing 1
Domestic Rabbit(100348465) homeobox containing 1
domestic guinea pig(100715846) homeobox containing 1
naked mole-rat(101699696) homeobox containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024567 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024567 Rosetta Predictions human pricing
XM_001066752 Rosetta Predictions rat pricing
XM_224289 Rosetta Predictions rat pricing
NM_177338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217799 predicted 591
2 SASI_Hs01_00217800 predicted 1359
3 SASI_Hs01_00217801 predicted 458
4 SASI_Hs01_00217802 predicted 886
5 SASI_Hs01_00217803 predicted 1583
6 SASI_Hs01_00217804 predicted 1369
7 SASI_Hs02_00356882 predicted 1221
8 SASI_Hs01_00217805 predicted 1022
9 SASI_Hs01_00217806 predicted 542
10 SASI_Hs01_00217807 predicted 445
11 SASI_Hs01_00217808 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318632 predicted 1583
2 SASI_Rn02_00318633 predicted 823
3 SASI_Rn02_00318634 predicted 1311
4 SASI_Rn02_00318635 predicted 1255
5 SASI_Rn02_00318636 predicted 883
6 SASI_Rn02_00318637 predicted 1145
7 SASI_Rn02_00318638 predicted 1671
8 SASI_Rn02_00318639 predicted 1637
9 SASI_Rn02_00318640 predicted 1608
10 SASI_Rn02_00318641 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381879 predicted 1582
2 SASI_Rn02_00381880 predicted 819
3 SASI_Rn02_00381881 predicted 1304
4 SASI_Rn02_00381882 predicted 1257
5 SASI_Rn02_00381883 predicted 889
6 SASI_Rn02_00381884 predicted 1143
7 SASI_Rn02_00381885 predicted 1667
8 SASI_Rn02_00381886 predicted 1645
9 SASI_Rn02_00381887 predicted 1605
10 SASI_Rn02_00381888 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026877 predicted 949
2 SASI_Mm01_00026878 predicted 1574
3 SASI_Mm01_00026879 predicted 440
4 SASI_Mm01_00026881 predicted 987
5 SASI_Mm01_00026884 predicted 816
6 SASI_Mm01_00026885 predicted 1658
7 SASI_Mm01_00026886 predicted 1632
8 SASI_Mm02_00347457 predicted 1587
9 SASI_Mm02_00347458 predicted 988
10 SASI_Mm02_00347459 predicted 1370
11 SASI_Mm01_00026880 predicted 1301
12 SASI_Mm01_00026882 predicted 1247
13 SASI_Mm01_00026883 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177338
VALIDATED
HMBOX1 MISSION shRNA Bacterial Glycerol Stock
homeobox containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177338.3-2582s1c1
Sequence:CCGGCCCAGAGTCATTAGGACTCTTCTCGAGAAGAGTCCTAATGACTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-436s21c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1161s21c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-437s1c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1162s1c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-356s1c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1136s1c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1135s21c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-355s21c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177338
VALIDATED
HMBOX1 MISSION shRNA shRNA Plasmid DNA
homeobox containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177338.3-2582s1c1
Sequence:CCGGCCCAGAGTCATTAGGACTCTTCTCGAGAAGAGTCCTAATGACTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-436s21c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1161s21c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-437s1c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1162s1c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-356s1c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1136s1c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1135s21c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-355s21c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177338
VALIDATED
HMBOX1 MISSION shRNA Lentiviral Transduction Particles
homeobox containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177338.3-2582s1c1
Sequence:CCGGCCCAGAGTCATTAGGACTCTTCTCGAGAAGAGTCCTAATGACTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-436s21c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1161s21c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-437s1c1
Sequence:CCGGCGGGATGACCAAACATGAAATCTCGAGATTTCATGTTTGGTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1162s1c1
Sequence:CCGGGCCTAGCTGTCATGGAAAGTTCTCGAGAACTTTCCATGACAGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-356s1c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177338.3-1136s1c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-1135s21c1
Sequence:CCGGGAGTAGATTTACCTGGAGAAACTCGAGTTTCTCCAGGTAAATCTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177338.5-355s21c1
Sequence:CCGGGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024567
VALIDATED
HMBOX1 MISSION shRNA Bacterial Glycerol Stock
homeobox containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-1299s1c1
Sequence:CCGGCCAACCAACCAACCAACCAAACTCGAGTTTGGTTGGTTGGTTGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-796s1c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-497s1c1
Sequence:CCGGCCGATGGTATCAACTTGAGAACTCGAGTTCTCAAGTTGATACCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024567.1-664s1c1
Sequence:CCGGGCCTGGCTGTTATGGAAAGTTCTCGAGAACTTTCCATAACAGCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-185s1c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-754s21c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1658s21c1
Sequence:CCGGGACTGATCAGGGAGGTTAAACCTCGAGGTTTAACCTCCCTGATCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1365s21c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1197s21c1
Sequence:CCGGTGCGACGAGGGAGTCGATTTACTCGAGTAAATCGACTCCCTCGTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024567.3-1943s21c1
Sequence:CCGGGAAAGTGCTTCCAGGTATTTACTCGAGTAAATACCTGGAAGCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024567
VALIDATED
HMBOX1 MISSION shRNA shRNA Plasmid DNA
homeobox containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-1299s1c1
Sequence:CCGGCCAACCAACCAACCAACCAAACTCGAGTTTGGTTGGTTGGTTGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-796s1c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-497s1c1
Sequence:CCGGCCGATGGTATCAACTTGAGAACTCGAGTTCTCAAGTTGATACCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024567.1-664s1c1
Sequence:CCGGGCCTGGCTGTTATGGAAAGTTCTCGAGAACTTTCCATAACAGCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-185s1c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-754s21c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1658s21c1
Sequence:CCGGGACTGATCAGGGAGGTTAAACCTCGAGGTTTAACCTCCCTGATCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1365s21c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1197s21c1
Sequence:CCGGTGCGACGAGGGAGTCGATTTACTCGAGTAAATCGACTCCCTCGTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024567.3-1943s21c1
Sequence:CCGGGAAAGTGCTTCCAGGTATTTACTCGAGTAAATACCTGGAAGCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024567
VALIDATED
HMBOX1 MISSION shRNA Lentiviral Transduction Particles
homeobox containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-1299s1c1
Sequence:CCGGCCAACCAACCAACCAACCAAACTCGAGTTTGGTTGGTTGGTTGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-796s1c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-497s1c1
Sequence:CCGGCCGATGGTATCAACTTGAGAACTCGAGTTCTCAAGTTGATACCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024567.1-664s1c1
Sequence:CCGGGCCTGGCTGTTATGGAAAGTTCTCGAGAACTTTCCATAACAGCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024567.1-185s1c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-754s21c1
Sequence:CCGGGAGGGAGAATAATGAGCGATTCTCGAGAATCGCTCATTATTCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1658s21c1
Sequence:CCGGGACTGATCAGGGAGGTTAAACCTCGAGGTTTAACCTCCCTGATCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1365s21c1
Sequence:CCGGCCTCCCTGAAAGTATATAATTCTCGAGAATTATATACTTTCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024567.3-1197s21c1
Sequence:CCGGTGCGACGAGGGAGTCGATTTACTCGAGTAAATCGACTCCCTCGTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024567.3-1943s21c1
Sequence:CCGGGAAAGTGCTTCCAGGTATTTACTCGAGTAAATACCTGGAAGCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)