EMAIL THIS PAGE TO A FRIEND

HMBS

hydroxymethylbilane synthase

90 Gene Product Result for
Synonyms: PBG-D PBGD PORC UPS
UniProtKB ID: P08397, A8K2L0, G3V1P4, G5EA58, P08396, Q16012
Gene ID:
Human(3145) Summary: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(15288) hydroxymethylbilane synthase
Rat(25709) hydroxymethylbilane synthase
chicken(419701) hydroxymethylbilane synthase
domestic cat(100127114) hydroxymethylbilane synthase
dog(489373) hydroxymethylbilane synthase
cow(515614) hydroxymethylbilane synthase
domestic guinea pig(100720802) hydroxymethylbilane synthase
naked mole-rat(101700818) hydroxymethylbilane synthase
Goat(100861215) hydroxymethylbilane synthase
Domestic Rabbit(100341318) hydroxymethylbilane synthase
sheep(100528012) hydroxymethylbilane synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000190 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000190 Rosetta Predictions human pricing
NM_001024382 Rosetta Predictions human pricing
NM_013168 Rosetta Predictions rat pricing
NM_001110251 Rosetta Predictions mouse pricing
NM_013551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091205 predicted 1219
2 SASI_Hs01_00091206 predicted 1168
3 SASI_Hs01_00091207 predicted 1099
4 SASI_Hs02_00302041 predicted 1209
5 SASI_Hs01_00091208 predicted 421
6 SASI_Hs01_00091210 predicted 877
7 SASI_Hs01_00091211 predicted 942
8 SASI_Hs01_00091212 predicted 620
9 SASI_Hs01_00091213 predicted 1034
10 SASI_Hs01_00091214 predicted 1080
11 SASI_Hs01_00091209 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212840 predicted 1117
2 SASI_Hs01_00212841 predicted 1070
3 SASI_Hs01_00212842 predicted 1000
4 SASI_Hs02_00307145 predicted 1109
5 SASI_Hs01_00212843 predicted 332
6 SASI_Hs01_00212845 predicted 776
7 SASI_Hs01_00212846 predicted 839
8 SASI_Hs01_00212847 predicted 521
9 SASI_Hs01_00212848 predicted 939
10 SASI_Hs01_00212849 predicted 978
11 SASI_Hs01_00212844 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048289 predicted 435
2 SASI_Rn01_00048290 predicted 1163
3 SASI_Rn01_00048291 predicted 863
4 SASI_Rn01_00048292 predicted 304
5 SASI_Rn01_00048293 predicted 267
6 SASI_Rn01_00048294 predicted 258
7 SASI_Rn01_00048295 predicted 970
8 SASI_Rn01_00048296 predicted 1189
9 SASI_Rn01_00048297 predicted 852
10 SASI_Rn02_00260991 predicted 319
11 SASI_Rn01_00048298 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305156 predicted 429
2 SASI_Mm02_00305157 predicted 418
3 SASI_Mm02_00305158 predicted 1035
4 SASI_Mm02_00305159 predicted 1177
5 SASI_Mm02_00305160 predicted 971
6 SASI_Mm02_00305161 predicted 1074
7 SASI_Mm02_00305162 predicted 1207
8 SASI_Mm02_00305163 predicted 814
9 SASI_Mm02_00305164 predicted 448
10 SASI_Mm02_00305165 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322273 predicted 488
2 SASI_Mm01_00087705 predicted 469
3 SASI_Mm02_00322274 predicted 1088
4 SASI_Mm02_00322275 predicted 1233
5 SASI_Mm01_00087711 predicted 1026
6 SASI_Mm02_00322276 predicted 1125
7 SASI_Mm02_00322277 predicted 1259
8 SASI_Mm02_00322278 predicted 865
9 SASI_Mm02_00322279 predicted 509
10 SASI_Mm02_00322280 predicted 1248
11 SASI_Mm01_00087702 predicted 881
12 SASI_Mm01_00087703 predicted 331
13 SASI_Mm01_00087704 predicted 289
14 SASI_Mm01_00087706 predicted 1198
15 SASI_Mm01_00087707 predicted 279
16 SASI_Mm01_00087708 predicted 350
17 SASI_Mm01_00087709 predicted 850
18 SASI_Mm01_00087710 predicted 1336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013551
VALIDATED
HMBS MISSION shRNA Bacterial Glycerol Stock
hydroxymethylbilane synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1225s21c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1395s21c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-491s21c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-324s21c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-553s21c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-451s1c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-513s1c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013551.1-1185s1c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-284s1c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-1355s1c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013551
VALIDATED
HMBS MISSION shRNA shRNA Plasmid DNA
hydroxymethylbilane synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1225s21c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1395s21c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-491s21c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-324s21c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-553s21c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-451s1c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-513s1c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013551.1-1185s1c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-284s1c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-1355s1c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013551
VALIDATED
HMBS MISSION shRNA Lentiviral Transduction Particles
hydroxymethylbilane synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1225s21c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-1395s21c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-491s21c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-324s21c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013551.2-553s21c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-451s1c1
Sequence:CCGGCCATACTACCTCCTGGCTTTACTCGAGTAAAGCCAGGAGGTAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-513s1c1
Sequence:CCGGGTTGTCTTTCACCCAAAGTTTCTCGAGAAACTTTGGGTGAAAGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013551.1-1185s1c1
Sequence:CCGGGCCAAGAACATCCTGGATGTTCTCGAGAACATCCAGGATGTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-284s1c1
Sequence:CCGGCCCTGGCATACAGTTTGAAATCTCGAGATTTCAAACTGTATGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013551.1-1355s1c1
Sequence:CCGGGACTTCCACTTTGGAAGATATCTCGAGATATCTTCCAAAGTGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000190
VALIDATED
HMBS MISSION shRNA Bacterial Glycerol Stock
hydroxymethylbilane synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-304s21c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1222s21c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-1172s21c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-430s21c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1015s21c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1166s1c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-1009s1c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-424s1c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1216s1c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-298s1c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000190
VALIDATED
HMBS MISSION shRNA shRNA Plasmid DNA
hydroxymethylbilane synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-304s21c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1222s21c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-1172s21c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-430s21c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1015s21c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1166s1c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-1009s1c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-424s1c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1216s1c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-298s1c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000190
VALIDATED
HMBS MISSION shRNA Lentiviral Transduction Particles
hydroxymethylbilane synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-304s21c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1222s21c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000190.3-1172s21c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-430s21c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000190.3-1015s21c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1166s1c1
Sequence:CCGGGCCAACTTGTTGCTGAGCAAACTCGAGTTTGCTCAGCAACAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-1009s1c1
Sequence:CCGGCGGCTCAGATAGCATACAAGACTCGAGTCTTGTATGCTATCTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-424s1c1
Sequence:CCGGCCTGGTTGTTCACTCCTTGAACTCGAGTTCAAGGAGTGAACAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000190.2-1216s1c1
Sequence:CCGGGCAGCTTAACGATGCCCATTACTCGAGTAATGGGCATCGTTAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000190.2-298s1c1
Sequence:CCGGGCAGTTTGAAATCATTGCTATCTCGAGATAGCAATGATTTCAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)