EMAIL THIS PAGE TO A FRIEND

HMCN1

hemicentin 1

118 Gene Product Result for
Synonyms: ARMD1 FBLN6 FIBL-6 FIBL6
UniProtKB ID: Q96RW7, A6NGE3, Q5TYR7, Q96DN3, Q96DN8, Q96SC3
Gene ID:
Human(83872) Summary: This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Mouse(545370) hemicentin 1
Rat(289094) hemicentin 1
Zebrafish(559150) hemicentin 1
cow(521326) hemicentin 1
Horse(100052277) hemicentin 1
dog(490318) hemicentin 1
chicken(429823) hemicentin 1
sheep(101109289) hemicentin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031935 Rosetta Predictions human pricing
XM_001070255 Rosetta Predictions rat pricing
XM_222716 Rosetta Predictions rat pricing
NM_001024720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359072 predicted 15476
2 SASI_Hs01_00236543 predicted 11653
3 SASI_Hs01_00236544 predicted 16325
4 SASI_Hs02_00359073 predicted 13932
5 SASI_Hs01_00236546 predicted 6509
6 SASI_Hs01_00236547 predicted 7290
7 SASI_Hs01_00236548 predicted 17151
8 SASI_Hs02_00359074 predicted 4019
9 SASI_Hs01_00236549 predicted 9699
10 SASI_Hs02_00359075 predicted 9033
11 SASI_Hs01_00236541 predicted 10869
12 SASI_Hs01_00236542 predicted 2531
13 SASI_Hs01_00236545 predicted 2697
14 SASI_Hs01_00236550 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331021 predicted 13833
2 SASI_Rn02_00331022 predicted 5726
3 SASI_Rn02_00331023 predicted 9467
4 SASI_Rn02_00331024 predicted 4998
5 SASI_Rn02_00331025 predicted 9186
6 SASI_Rn02_00331026 predicted 13593
7 SASI_Rn02_00331027 predicted 1862
8 SASI_Rn02_00331028 predicted 11565
9 SASI_Rn02_00331029 predicted 4658
10 SASI_Rn02_00331030 predicted 12906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380865 predicted 13737
2 SASI_Rn02_00380866 predicted 5630
3 SASI_Rn02_00380867 predicted 9368
4 SASI_Rn02_00380868 predicted 4900
5 SASI_Rn02_00380869 predicted 9084
6 SASI_Rn02_00380870 predicted 13486
7 SASI_Rn02_00380871 predicted 1761
8 SASI_Rn02_00380872 predicted 11467
9 SASI_Rn02_00380873 predicted 4563
10 SASI_Rn02_00380874 predicted 12803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287696 predicted 7494
2 SASI_Mm02_00287697 predicted 1494
3 SASI_Mm02_00287698 predicted 16446
4 SASI_Mm02_00287699 predicted 5000
5 SASI_Mm02_00287700 predicted 13843
6 SASI_Mm02_00287701 predicted 16690
7 SASI_Mm02_00287702 predicted 12903
8 SASI_Mm02_00287703 predicted 5725
9 SASI_Mm02_00287704 predicted 5334
10 SASI_Mm02_00287705 predicted 15570
11 SASI_Mm01_00044499 predicted 1015
12 SASI_Mm01_00044500 predicted 1121
13 SASI_Mm01_00044501 predicted 607
14 SASI_Mm01_00044502 predicted 1048
15 SASI_Mm01_00044503 predicted 651
16 SASI_Mm01_00044504 predicted 670
17 SASI_Mm01_00044505 predicted 796
18 SASI_Mm01_00044506 predicted 1147
19 SASI_Mm01_00044507 predicted 843
20 SASI_Mm01_00044508 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024720
HMCN1 MISSION shRNA Bacterial Glycerol Stock
hemicentin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-1947s21c1
Sequence:CCGGGATCATCCAACTGCCTAATAACTCGAGTTATTAGGCAGTTGGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-12239s21c1
Sequence:CCGGAGATACCTACTACCCAATTAACTCGAGTTAATTGGGTAGTAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024720.3-17712s21c1
Sequence:CCGGATAAACGCTTATGCCATAATACTCGAGTATTATGGCATAAGCGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-3857s21c1
Sequence:CCGGATGTGACTCAGTCCGTTAAATCTCGAGATTTAACGGACTGAGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-6680s21c1
Sequence:CCGGTCTATGCTCCACCCAATATTACTCGAGTAATATTGGGTGGAGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024720
HMCN1 MISSION shRNA shRNA Plasmid DNA
hemicentin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-1947s21c1
Sequence:CCGGGATCATCCAACTGCCTAATAACTCGAGTTATTAGGCAGTTGGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-12239s21c1
Sequence:CCGGAGATACCTACTACCCAATTAACTCGAGTTAATTGGGTAGTAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024720.3-17712s21c1
Sequence:CCGGATAAACGCTTATGCCATAATACTCGAGTATTATGGCATAAGCGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-3857s21c1
Sequence:CCGGATGTGACTCAGTCCGTTAAATCTCGAGATTTAACGGACTGAGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-6680s21c1
Sequence:CCGGTCTATGCTCCACCCAATATTACTCGAGTAATATTGGGTGGAGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024720
HMCN1 MISSION shRNA Lentiviral Transduction Particles
hemicentin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-1947s21c1
Sequence:CCGGGATCATCCAACTGCCTAATAACTCGAGTTATTAGGCAGTTGGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-12239s21c1
Sequence:CCGGAGATACCTACTACCCAATTAACTCGAGTTAATTGGGTAGTAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024720.3-17712s21c1
Sequence:CCGGATAAACGCTTATGCCATAATACTCGAGTATTATGGCATAAGCGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-3857s21c1
Sequence:CCGGATGTGACTCAGTCCGTTAAATCTCGAGATTTAACGGACTGAGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024720.3-6680s21c1
Sequence:CCGGTCTATGCTCCACCCAATATTACTCGAGTAATATTGGGTGGAGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031935
HMCN1 MISSION shRNA Bacterial Glycerol Stock
hemicentin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-8836s1c1
Sequence:CCGGGCCAATTATCAAGGGAGCAAACTCGAGTTTGCTCCCTTGATAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-12552s1c1
Sequence:CCGGCGCCTGACATTACATGGCATACTCGAGTATGCCATGTAATGTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-13136s1c1
Sequence:CCGGGCCCACTTTGACAGTGTGAATCTCGAGATTCACACTGTCAAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-6076s1c1
Sequence:CCGGGCCTGTTATTACATGGTACAACTCGAGTTGTACCATGTAATAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-2458s1c1
Sequence:CCGGGCCCTCAACATTCCTCATTATCTCGAGATAATGAGGAATGTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031935
HMCN1 MISSION shRNA shRNA Plasmid DNA
hemicentin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-8836s1c1
Sequence:CCGGGCCAATTATCAAGGGAGCAAACTCGAGTTTGCTCCCTTGATAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-12552s1c1
Sequence:CCGGCGCCTGACATTACATGGCATACTCGAGTATGCCATGTAATGTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-13136s1c1
Sequence:CCGGGCCCACTTTGACAGTGTGAATCTCGAGATTCACACTGTCAAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-6076s1c1
Sequence:CCGGGCCTGTTATTACATGGTACAACTCGAGTTGTACCATGTAATAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-2458s1c1
Sequence:CCGGGCCCTCAACATTCCTCATTATCTCGAGATAATGAGGAATGTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031935
HMCN1 MISSION shRNA Lentiviral Transduction Particles
hemicentin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-8836s1c1
Sequence:CCGGGCCAATTATCAAGGGAGCAAACTCGAGTTTGCTCCCTTGATAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-12552s1c1
Sequence:CCGGCGCCTGACATTACATGGCATACTCGAGTATGCCATGTAATGTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-13136s1c1
Sequence:CCGGGCCCACTTTGACAGTGTGAATCTCGAGATTCACACTGTCAAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-6076s1c1
Sequence:CCGGGCCTGTTATTACATGGTACAACTCGAGTTGTACCATGTAATAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031935.1-2458s1c1
Sequence:CCGGGCCCTCAACATTCCTCATTATCTCGAGATAATGAGGAATGTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)