EMAIL THIS PAGE TO A FRIEND

HMCN2

hemicentin 2

67 Gene Product Result for
UniProtKB ID: Q8NDA2, Q8N225, Q8TCI8
Gene ID:
Mouse(665700) hemicentin 2
Rat(686132) hemicentin 2
sheep(101101882) hemicentin 2
Zebrafish(565032) hemicentin 2
dog(491293) hemicentin 2
cow(534512) hemicentin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_175125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_175125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_175125 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147691 MISSION® esiRNA esiRNA human HMCN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715154 Rosetta Predictions human pricing
XM_001726942 Rosetta Predictions human pricing
XM_175125 Rosetta Predictions human pricing
NM_001109494 Rosetta Predictions rat pricing
NM_177649 Rosetta Predictions mouse pricing
XM_978791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401810 predicted 4250
2 SASI_Hs02_00401811 predicted 4856
3 SASI_Hs02_00401812 predicted 6873
4 SASI_Hs02_00401813 predicted 5705
5 SASI_Hs02_00401814 predicted 8016
6 SASI_Hs02_00401815 predicted 3676
7 SASI_Hs02_00401816 predicted 5886
8 SASI_Hs02_00401817 predicted 2298
9 SASI_Hs02_00401818 predicted 9665
10 SASI_Hs02_00401819 predicted 5709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477585 predicted 3970
2 SASI_Hs02_00477586 predicted 4583
3 SASI_Hs02_00477587 predicted 6604
4 SASI_Hs02_00477588 predicted 5428
5 SASI_Hs02_00477589 predicted 7739
6 SASI_Hs02_00477590 predicted 3407
7 SASI_Hs02_00477591 predicted 2030
8 SASI_Hs02_00477592 predicted 9389
9 SASI_Hs02_00477593 predicted 2596
10 SASI_Hs02_00477594 predicted 5615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_175125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252670 predicted 3788
2 SASI_Hs01_00252671 predicted 4402
3 SASI_Hs01_00252672 predicted 6390
4 SASI_Hs01_00252673 predicted 5226
5 SASI_Hs01_00252674 predicted 3227
6 SASI_Hs01_00252675 predicted 9317
7 SASI_Hs01_00252676 predicted 444
8 SASI_Hs01_00252677 predicted 9147
9 SASI_Hs01_00252678 predicted 1849
10 SASI_Hs01_00252679 predicted 2415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248949 predicted 1035
2 SASI_Rn02_00248950 predicted 470
3 SASI_Rn02_00248951 predicted 579
4 SASI_Rn02_00248952 predicted 700
5 SASI_Rn02_00248953 predicted 1870
6 SASI_Rn02_00248954 predicted 1285
7 SASI_Rn02_00248955 predicted 923
8 SASI_Rn02_00248956 predicted 564
9 SASI_Rn02_00248957 predicted 1658
10 SASI_Rn02_00248958 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024592 predicted 571
2 SASI_Mm01_00024593 predicted 584
3 SASI_Mm01_00024594 predicted 1106
4 SASI_Mm01_00024595 predicted 601
5 SASI_Mm01_00024596 predicted 761
6 SASI_Mm01_00024597 predicted 1967
7 SASI_Mm01_00024598 predicted 480
8 SASI_Mm01_00024599 predicted 985
9 SASI_Mm01_00024600 predicted 1670
10 SASI_Mm01_00024601 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225535 predicted 1072
2 SASI_Mm01_00225536 predicted 847
3 SASI_Mm01_00225537 predicted 925
4 SASI_Mm01_00225538 predicted 931
5 SASI_Mm01_00225539 predicted 1283
6 SASI_Mm01_00225540 predicted 499
7 SASI_Mm01_00225541 predicted 1241
8 SASI_Mm01_00225542 predicted 1297
9 SASI_Mm01_00225543 predicted 1528
10 SASI_Mm01_00225544 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177649
HMCN2 MISSION shRNA Bacterial Glycerol Stock
hemicentin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177649.3-2719s1c1
Sequence:CCGGCCCTTTGATGGCAAAGCCAATCTCGAGATTGGCTTTGCCATCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1533s1c1
Sequence:CCGGGATGAGTGTCACTACAATCAACTCGAGTTGATTGTAGTGACACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-571s1c1
Sequence:CCGGGAGTCATCAATGGTCAGGAATCTCGAGATTCCTGACCATTGATGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1529s1c1
Sequence:CCGGGCTGGATGAGTGTCACTACAACTCGAGTTGTAGTGACACTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-2504s1c1
Sequence:CCGGGAGCGTCTACATCCTGCTAATCTCGAGATTAGCAGGATGTAGACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177649
HMCN2 MISSION shRNA shRNA Plasmid DNA
hemicentin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177649.3-2719s1c1
Sequence:CCGGCCCTTTGATGGCAAAGCCAATCTCGAGATTGGCTTTGCCATCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1533s1c1
Sequence:CCGGGATGAGTGTCACTACAATCAACTCGAGTTGATTGTAGTGACACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-571s1c1
Sequence:CCGGGAGTCATCAATGGTCAGGAATCTCGAGATTCCTGACCATTGATGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1529s1c1
Sequence:CCGGGCTGGATGAGTGTCACTACAACTCGAGTTGTAGTGACACTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-2504s1c1
Sequence:CCGGGAGCGTCTACATCCTGCTAATCTCGAGATTAGCAGGATGTAGACGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177649
HMCN2 MISSION shRNA Lentiviral Transduction Particles
hemicentin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177649.3-2719s1c1
Sequence:CCGGCCCTTTGATGGCAAAGCCAATCTCGAGATTGGCTTTGCCATCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1533s1c1
Sequence:CCGGGATGAGTGTCACTACAATCAACTCGAGTTGATTGTAGTGACACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-571s1c1
Sequence:CCGGGAGTCATCAATGGTCAGGAATCTCGAGATTCCTGACCATTGATGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-1529s1c1
Sequence:CCGGGCTGGATGAGTGTCACTACAACTCGAGTTGTAGTGACACTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177649.3-2504s1c1
Sequence:CCGGGAGCGTCTACATCCTGCTAATCTCGAGATTAGCAGGATGTAGACGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_175125
HMCN2 MISSION shRNA Bacterial Glycerol Stock
hemicentin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-2490s1c1
Sequence:CCGGCCACTCAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-5159s1c1
Sequence:CCGGCCCAGGTATCGGATAAAGGTTCTCGAGAACCTTTATCCGATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-8713s1c1
Sequence:CCGGCCGGACATCCACTGGATCAAACTCGAGTTTGATCCAGTGGATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-6453s1c1
Sequence:CCGGGCCCAACATCACCTGGCATAACTCGAGTTATGCCAGGTGATGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-3349s1c1
Sequence:CCGGCCCAAGCTCACATGGTTCAAACTCGAGTTTGAACCATGTGAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_175125
HMCN2 MISSION shRNA shRNA Plasmid DNA
hemicentin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-2490s1c1
Sequence:CCGGCCACTCAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-5159s1c1
Sequence:CCGGCCCAGGTATCGGATAAAGGTTCTCGAGAACCTTTATCCGATACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-8713s1c1
Sequence:CCGGCCGGACATCCACTGGATCAAACTCGAGTTTGATCCAGTGGATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-6453s1c1
Sequence:CCGGGCCCAACATCACCTGGCATAACTCGAGTTATGCCAGGTGATGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-3349s1c1
Sequence:CCGGCCCAAGCTCACATGGTTCAAACTCGAGTTTGAACCATGTGAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_175125
HMCN2 MISSION shRNA Lentiviral Transduction Particles
hemicentin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-2490s1c1
Sequence:CCGGCCACTCAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-5159s1c1
Sequence:CCGGCCCAGGTATCGGATAAAGGTTCTCGAGAACCTTTATCCGATACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-8713s1c1
Sequence:CCGGCCGGACATCCACTGGATCAAACTCGAGTTTGATCCAGTGGATGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-6453s1c1
Sequence:CCGGGCCCAACATCACCTGGCATAACTCGAGTTATGCCAGGTGATGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_175125.4-3349s1c1
Sequence:CCGGCCCAAGCTCACATGGTTCAAACTCGAGTTTGAACCATGTGAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)