EMAIL THIS PAGE TO A FRIEND

HMG20A

high mobility group 20A

145 Gene Product Result for
Synonyms: HMGX1 HMGXB1
UniProtKB ID: Q9NP66, A6NHY3, D3DW78, Q53G31, Q9NSF6
Gene ID:
Mouse(66867) high mobility group 20A
Rat(315689) high mobility group 20A
Zebrafish(326908) high-mobility group 20A
cow(513719) high mobility group 20A
dog(487661) high mobility group 20A
Horse(100061369) high mobility group 20A
domestic cat(101096572) high mobility group 20A
chicken(415346) high mobility group 20A
domestic guinea pig(100723235) high mobility group 20A
naked mole-rat(101722091) high mobility group 20A
sheep(101104609) high mobility group 20A
Domestic Rabbit(100342591) high mobility group 20A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018200 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018200 Rosetta Predictions human pricing
NM_001108150 Rosetta Predictions rat pricing
XM_236267 Rosetta Predictions rat pricing
NM_025812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090308 predicted 549
2 SASI_Hs01_00090309 predicted 858
3 SASI_Hs01_00090310 predicted 343
4 SASI_Hs01_00090311 predicted 821
5 SASI_Hs01_00090312 predicted 322
6 SASI_Hs01_00090313 predicted 1126
7 SASI_Hs01_00090314 predicted 521
8 SASI_Hs01_00090315 predicted 522
9 SASI_Hs01_00090316 predicted 409
10 SASI_Hs02_00351486 predicted 1261
11 SASI_Hs01_00090307 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235854 predicted 599
2 SASI_Rn02_00235855 predicted 350
3 SASI_Rn02_00235856 predicted 1319
4 SASI_Rn02_00235857 predicted 1371
5 SASI_Rn02_00235858 predicted 968
6 SASI_Rn02_00235859 predicted 893
7 SASI_Rn02_00235860 predicted 1205
8 SASI_Rn02_00235861 predicted 1101
9 SASI_Rn02_00235862 predicted 275
10 SASI_Rn02_00235863 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170531 predicted 1322
2 SASI_Rn01_00170532 predicted 1398
3 SASI_Rn01_00170533 predicted 1447
4 SASI_Rn01_00170534 predicted 1388
5 SASI_Rn01_00170535 predicted 1294
6 SASI_Rn01_00170536 predicted 1435
7 SASI_Rn01_00170537 predicted 1224
8 SASI_Rn01_00170538 predicted 1248
9 SASI_Rn01_00170539 predicted 1345
10 SASI_Rn01_00170540 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144946 predicted 403
2 SASI_Mm01_00144947 predicted 765
3 SASI_Mm01_00144948 predicted 732
4 SASI_Mm01_00144949 predicted 355
5 SASI_Mm01_00144950 predicted 1133
6 SASI_Mm01_00144951 predicted 1014
7 SASI_Mm01_00144952 predicted 430
8 SASI_Mm01_00144953 predicted 1157
9 SASI_Mm01_00144954 predicted 1182
10 SASI_Mm01_00144955 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025812
VALIDATED
HMG20A MISSION shRNA Bacterial Glycerol Stock
high mobility group 20A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025812.2-2200s21c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1111s21c1
Sequence:CCGGGTGAACAGGCTTGATCGTTAACTCGAGTTAACGATCAAGCCTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1038s21c1
Sequence:CCGGGAACAGATTGCACAGTATAATCTCGAGATTATACTGTGCAATCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-497s21c1
Sequence:CCGGTGGGCAATGAGTGGAGTAAACCTCGAGGTTTACTCCACTCATTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-805s21c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-2200s1c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-805s1c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-740s1c1
Sequence:CCGGTCCCTATATTTACCGAAGAATCTCGAGATTCTTCGGTAAATATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-405s1c1
Sequence:CCGGCCTTACAGGATATGTTCGATTCTCGAGAATCGAACATATCCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-741s1c1
Sequence:CCGGCCCTATATTTACCGAAGAATTCTCGAGAATTCTTCGGTAAATATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025812
VALIDATED
HMG20A MISSION shRNA shRNA Plasmid DNA
high mobility group 20A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025812.2-2200s21c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1111s21c1
Sequence:CCGGGTGAACAGGCTTGATCGTTAACTCGAGTTAACGATCAAGCCTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1038s21c1
Sequence:CCGGGAACAGATTGCACAGTATAATCTCGAGATTATACTGTGCAATCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-497s21c1
Sequence:CCGGTGGGCAATGAGTGGAGTAAACCTCGAGGTTTACTCCACTCATTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-805s21c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-2200s1c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-805s1c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-740s1c1
Sequence:CCGGTCCCTATATTTACCGAAGAATCTCGAGATTCTTCGGTAAATATAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-405s1c1
Sequence:CCGGCCTTACAGGATATGTTCGATTCTCGAGAATCGAACATATCCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-741s1c1
Sequence:CCGGCCCTATATTTACCGAAGAATTCTCGAGAATTCTTCGGTAAATATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025812
VALIDATED
HMG20A MISSION shRNA Lentiviral Transduction Particles
high mobility group 20A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025812.2-2200s21c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1111s21c1
Sequence:CCGGGTGAACAGGCTTGATCGTTAACTCGAGTTAACGATCAAGCCTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-1038s21c1
Sequence:CCGGGAACAGATTGCACAGTATAATCTCGAGATTATACTGTGCAATCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-497s21c1
Sequence:CCGGTGGGCAATGAGTGGAGTAAACCTCGAGGTTTACTCCACTCATTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025812.2-805s21c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-2200s1c1
Sequence:CCGGCCCTCTCCTTACTAAGGAATTCTCGAGAATTCCTTAGTAAGGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-805s1c1
Sequence:CCGGCGTAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-740s1c1
Sequence:CCGGTCCCTATATTTACCGAAGAATCTCGAGATTCTTCGGTAAATATAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-405s1c1
Sequence:CCGGCCTTACAGGATATGTTCGATTCTCGAGAATCGAACATATCCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025812.2-741s1c1
Sequence:CCGGCCCTATATTTACCGAAGAATTCTCGAGAATTCTTCGGTAAATATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018200
VALIDATED
HMG20A MISSION shRNA Bacterial Glycerol Stock
high mobility group 20A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-919s21c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1413s21c1
Sequence:CCGGGAGGGAGCAGCAACATGTATACTCGAGTATACATGTTGCTGCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-325s21c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-430s21c1
Sequence:CCGGGAAGATGAGCAACGAAGTAAACTCGAGTTTACTTCGTTGCTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1129s21c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-1129s1c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-854s1c1
Sequence:CCGGTCCCTATATTTACAGAGGAATCTCGAGATTCCTCTGTAAATATAGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-919s1c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-519s1c1
Sequence:CCGGCCTTACAGGATATGTTCGGTTCTCGAGAACCGAACATATCCTGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-325s1c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018200
VALIDATED
HMG20A MISSION shRNA shRNA Plasmid DNA
high mobility group 20A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-919s21c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1413s21c1
Sequence:CCGGGAGGGAGCAGCAACATGTATACTCGAGTATACATGTTGCTGCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-325s21c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-430s21c1
Sequence:CCGGGAAGATGAGCAACGAAGTAAACTCGAGTTTACTTCGTTGCTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1129s21c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-1129s1c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-854s1c1
Sequence:CCGGTCCCTATATTTACAGAGGAATCTCGAGATTCCTCTGTAAATATAGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-919s1c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-519s1c1
Sequence:CCGGCCTTACAGGATATGTTCGGTTCTCGAGAACCGAACATATCCTGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-325s1c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018200
VALIDATED
HMG20A MISSION shRNA Lentiviral Transduction Particles
high mobility group 20A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-919s21c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1413s21c1
Sequence:CCGGGAGGGAGCAGCAACATGTATACTCGAGTATACATGTTGCTGCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-325s21c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-430s21c1
Sequence:CCGGGAAGATGAGCAACGAAGTAAACTCGAGTTTACTTCGTTGCTCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018200.2-1129s21c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-1129s1c1
Sequence:CCGGGTGGACACCATTGACTCATATCTCGAGATATGAGTCAATGGTGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-854s1c1
Sequence:CCGGTCCCTATATTTACAGAGGAATCTCGAGATTCCTCTGTAAATATAGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-919s1c1
Sequence:CCGGCGCAAATCCAACATGGAGTTTCTCGAGAAACTCCATGTTGGATTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018200.2-519s1c1
Sequence:CCGGCCTTACAGGATATGTTCGGTTCTCGAGAACCGAACATATCCTGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018200.2-325s1c1
Sequence:CCGGGCCACATCATCCACCAACAATCTCGAGATTGTTGGTGGATGATGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)