EMAIL THIS PAGE TO A FRIEND

HMG20B

high mobility group 20B

64 Gene Product Result for
Synonyms: BRAF25 BRAF35 HMGX2 HMGXB2 PP7706 SMARCE1r SOXL pp8857
Gene ID:
Mouse(15353) high mobility group 20B
Rat(362825) high mobility group 20 B
sheep(101116309) high mobility group 20B
domestic guinea pig(100717032) high mobility group 20B
naked mole-rat(101697717) high mobility group 20B
Zebrafish(553572) high-mobility group 20B
cow(507723) high mobility group 20B
domestic cat(101088553) high mobility group 20B
dog(612026) high mobility group 20B
chicken(426515) high mobility group 20B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408752 Anti-HMG20B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV37058 Anti-HMG20B antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB2101048 Anti-HMG20B antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1408662 Anti-HMG20B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB4500086 Anti-HMG20B antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2106449 Anti-HMG20B antibody produced in rabbit affinity isolated antibody human, guinea pig, dog, bovine, rat
western blot pricing
HPA069832 Anti-HMG20B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA050220 Anti-HMG20B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA053157 Anti-HMG20B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0010362M1 Monoclonal Anti-HMG20B antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0166 Rabbit anti-HMG20B/BRAF35 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006339 Rosetta Predictions human pricing
NM_001108731 Rosetta Predictions rat pricing
NM_010440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181532 predicted 664
2 SASI_Hs02_00341374 predicted 351
3 SASI_Hs01_00181533 predicted 609
4 SASI_Hs01_00181534 predicted 389
5 SASI_Hs01_00181535 predicted 336
6 SASI_Hs01_00181536 predicted 489
7 SASI_Hs01_00181537 predicted 625
8 SASI_Hs01_00181538 predicted 473
9 SASI_Hs01_00181539 predicted 555
10 SASI_Hs01_00181540 predicted 1168
11 SASI_Hs01_00181541 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241525 predicted 1427
2 SASI_Rn02_00241526 predicted 1443
3 SASI_Rn02_00241527 predicted 1130
4 SASI_Rn02_00241528 predicted 1378
5 SASI_Rn02_00241529 predicted 1425
6 SASI_Rn02_00241530 predicted 1068
7 SASI_Rn02_00241531 predicted 1203
8 SASI_Rn02_00241532 predicted 1233
9 SASI_Rn02_00241533 predicted 1050
10 SASI_Rn02_00241534 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084735 predicted 663
2 SASI_Mm02_00318592 predicted 461
3 SASI_Mm01_00084737 predicted 309
4 SASI_Mm01_00084738 predicted 417
5 SASI_Mm02_00318593 predicted 304
6 SASI_Mm01_00084739 predicted 457
7 SASI_Mm01_00084740 predicted 516
8 SASI_Mm01_00084741 predicted 969
9 SASI_Mm01_00084742 predicted 520
10 SASI_Mm01_00084743 predicted 723
11 SASI_Mm01_00084736 predicted 717
12 SASI_Mm01_00084744 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010440
VALIDATED
HMG20B MISSION shRNA Bacterial Glycerol Stock
high mobility group 20B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-464s1c1
Sequence:CCGGTGGCTATGTTCGCTTCCTGAACTCGAGTTCAGGAAGCGAACATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-730s21c1
Sequence:CCGGTCATGAACACCCTCCTGAATGCTCGAGCATTCAGGAGGGTGTTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-795s1c1
Sequence:CCGGCCCATCTTCACGGAAGAGTTTCTCGAGAAACTCTTCCGTGAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010440.1-1231s1c1
Sequence:CCGGCCCAGAAAGAAGCTACACCTTCTCGAGAAGGTGTAGCTTCTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-672s1c1
Sequence:CCGGGTCTGCACTGAGAAGATTCAACTCGAGTTGAATCTTCTCAGTGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010440.1-530s1c1
Sequence:CCGGCCCGGAGATCACGAAGATGTTCTCGAGAACATCTTCGTGATCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-424s21c1
Sequence:GTACCGGGAAAGAAGATTCTCCCAAATGCTCGAGCATTTGGGAGAATCTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-1283s21c1
Sequence:CCGGCAACCGCATCCCTTTAGCTTCCTCGAGGAAGCTAAAGGGATGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-670s21c1
Sequence:CCGGAGGTCTGCACTGAGAAGATTCCTCGAGGAATCTTCTCAGTGCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-527s21c1
Sequence:CCGGATTCCCGGAGATCACGAAGATCTCGAGATCTTCGTGATCTCCGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010440
VALIDATED
HMG20B MISSION shRNA shRNA Plasmid DNA
high mobility group 20B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-464s1c1
Sequence:CCGGTGGCTATGTTCGCTTCCTGAACTCGAGTTCAGGAAGCGAACATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-730s21c1
Sequence:CCGGTCATGAACACCCTCCTGAATGCTCGAGCATTCAGGAGGGTGTTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-795s1c1
Sequence:CCGGCCCATCTTCACGGAAGAGTTTCTCGAGAAACTCTTCCGTGAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010440.1-1231s1c1
Sequence:CCGGCCCAGAAAGAAGCTACACCTTCTCGAGAAGGTGTAGCTTCTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-672s1c1
Sequence:CCGGGTCTGCACTGAGAAGATTCAACTCGAGTTGAATCTTCTCAGTGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010440.1-530s1c1
Sequence:CCGGCCCGGAGATCACGAAGATGTTCTCGAGAACATCTTCGTGATCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-424s21c1
Sequence:GTACCGGGAAAGAAGATTCTCCCAAATGCTCGAGCATTTGGGAGAATCTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-1283s21c1
Sequence:CCGGCAACCGCATCCCTTTAGCTTCCTCGAGGAAGCTAAAGGGATGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-670s21c1
Sequence:CCGGAGGTCTGCACTGAGAAGATTCCTCGAGGAATCTTCTCAGTGCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-527s21c1
Sequence:CCGGATTCCCGGAGATCACGAAGATCTCGAGATCTTCGTGATCTCCGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010440
VALIDATED
HMG20B MISSION shRNA Lentiviral Transduction Particles
high mobility group 20B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-464s1c1
Sequence:CCGGTGGCTATGTTCGCTTCCTGAACTCGAGTTCAGGAAGCGAACATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-730s21c1
Sequence:CCGGTCATGAACACCCTCCTGAATGCTCGAGCATTCAGGAGGGTGTTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-795s1c1
Sequence:CCGGCCCATCTTCACGGAAGAGTTTCTCGAGAAACTCTTCCGTGAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010440.1-1231s1c1
Sequence:CCGGCCCAGAAAGAAGCTACACCTTCTCGAGAAGGTGTAGCTTCTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010440.1-672s1c1
Sequence:CCGGGTCTGCACTGAGAAGATTCAACTCGAGTTGAATCTTCTCAGTGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010440.1-530s1c1
Sequence:CCGGCCCGGAGATCACGAAGATGTTCTCGAGAACATCTTCGTGATCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-424s21c1
Sequence:GTACCGGGAAAGAAGATTCTCCCAAATGCTCGAGCATTTGGGAGAATCTTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-1283s21c1
Sequence:CCGGCAACCGCATCCCTTTAGCTTCCTCGAGGAAGCTAAAGGGATGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-670s21c1
Sequence:CCGGAGGTCTGCACTGAGAAGATTCCTCGAGGAATCTTCTCAGTGCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010440.2-527s21c1
Sequence:CCGGATTCCCGGAGATCACGAAGATCTCGAGATCTTCGTGATCTCCGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006339
VALIDATED
HMG20B MISSION shRNA Bacterial Glycerol Stock
high mobility group 20B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-201s1c1
Sequence:CCGGGCTCATGAACACTCTCCTGAACTCGAGTTCAGGAGAGTGTTCATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-123s1c1
Sequence:CCGGCCAGCAGTCTGAAGCCTATAACTCGAGTTATAGGCTTCAGACTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-820s1c1
Sequence:CCGGAGCATCCCTTTAGCTTTCAATCTCGAGATTGAAAGCTAAAGGGATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-607s1c1
Sequence:CCGGCGAGAAGCTCATCGTCCGCATCTCGAGATGCGGACGATGAGCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-330s1c1
Sequence:CCGGGCGGAAGATGAATGTGGCCTTCTCGAGAAGGCCACATTCATCTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-971s21c1
Sequence:CCGGCATCGTCCGCATCAAGGAAATCTCGAGATTTCCTTGATGCGGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-559s21c1
Sequence:CCGGTCATGAACACTCTCCTGAATGCTCGAGCATTCAGGAGAGTGTTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-349s21c1
Sequence:CCGGATCTGCCCTTTCCCGAGATCACTCGAGTGATCTCGGGAAAGGGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006339
VALIDATED
HMG20B MISSION shRNA shRNA Plasmid DNA
high mobility group 20B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-201s1c1
Sequence:CCGGGCTCATGAACACTCTCCTGAACTCGAGTTCAGGAGAGTGTTCATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-123s1c1
Sequence:CCGGCCAGCAGTCTGAAGCCTATAACTCGAGTTATAGGCTTCAGACTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-820s1c1
Sequence:CCGGAGCATCCCTTTAGCTTTCAATCTCGAGATTGAAAGCTAAAGGGATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-607s1c1
Sequence:CCGGCGAGAAGCTCATCGTCCGCATCTCGAGATGCGGACGATGAGCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-330s1c1
Sequence:CCGGGCGGAAGATGAATGTGGCCTTCTCGAGAAGGCCACATTCATCTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-971s21c1
Sequence:CCGGCATCGTCCGCATCAAGGAAATCTCGAGATTTCCTTGATGCGGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-559s21c1
Sequence:CCGGTCATGAACACTCTCCTGAATGCTCGAGCATTCAGGAGAGTGTTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-349s21c1
Sequence:CCGGATCTGCCCTTTCCCGAGATCACTCGAGTGATCTCGGGAAAGGGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006339
VALIDATED
HMG20B MISSION shRNA Lentiviral Transduction Particles
high mobility group 20B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-201s1c1
Sequence:CCGGGCTCATGAACACTCTCCTGAACTCGAGTTCAGGAGAGTGTTCATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-123s1c1
Sequence:CCGGCCAGCAGTCTGAAGCCTATAACTCGAGTTATAGGCTTCAGACTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-820s1c1
Sequence:CCGGAGCATCCCTTTAGCTTTCAATCTCGAGATTGAAAGCTAAAGGGATGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006339.1-607s1c1
Sequence:CCGGCGAGAAGCTCATCGTCCGCATCTCGAGATGCGGACGATGAGCTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006339.1-330s1c1
Sequence:CCGGGCGGAAGATGAATGTGGCCTTCTCGAGAAGGCCACATTCATCTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-971s21c1
Sequence:CCGGCATCGTCCGCATCAAGGAAATCTCGAGATTTCCTTGATGCGGACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-559s21c1
Sequence:CCGGTCATGAACACTCTCCTGAATGCTCGAGCATTCAGGAGAGTGTTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006339.2-349s21c1
Sequence:CCGGATCTGCCCTTTCCCGAGATCACTCGAGTGATCTCGGGAAAGGGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)