EMAIL THIS PAGE TO A FRIEND

HMGA1

high mobility group AT-hook 1

270 Gene Product Result for
Synonyms: HMG-R HMGA1A HMGIY
UniProtKB ID: P17096, P10910, Q5T6U9, Q9UKB0
Gene ID:
Human(3159) Summary: This gene encodes a non-histone protein involved in many cellular processes, including regulation of inducible gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of A+T-rich regions in double-stranded DNA. It has little secondary structure in solution but assumes distinct conformations when bound to substrates such as DNA or other proteins. The encoded protein is frequently acetylated and is found in the nucleus. At least seven transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15361) high mobility group AT-hook 1
Rat(117062) high mobility group AT-hook 1
chicken(378795) high mobility group AT-hook 1
dog(442946) high mobility group AT-hook 1
domestic cat(101094850) high mobility group AT-hook 1
cow(618849) high mobility group AT-hook 1
domestic guinea pig(100727514) high mobility group AT-hook 1
naked mole-rat(101700395) high mobility group AT-hook 1
sheep(101114820) high mobility group AT-hook 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLL1036 U2OS GFP-HMGA1 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002131 Rosetta Predictions human pricing
NM_145899 Rosetta Predictions human pricing
NM_145901 Rosetta Predictions human pricing
NM_145902 Rosetta Predictions human pricing
NM_145903 Rosetta Predictions human pricing
NM_145904 Rosetta Predictions human pricing
NM_145905 Rosetta Predictions human pricing
NM_139327 Rosetta Predictions rat pricing
NM_001025427 Rosetta Predictions mouse pricing
NM_001039356 Rosetta Predictions mouse pricing
NM_016660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134689 predicted 991
2 SASI_Hs01_00134691 predicted 905
3 SASI_Hs01_00134693 predicted 997
4 SASI_Hs01_00134694 predicted 911
5 SASI_Hs02_00333278 predicted 820
6 SASI_Hs02_00333279 predicted 341
7 SASI_Hs02_00333280 predicted 1348
8 SASI_Hs02_00333281 predicted 1572
9 SASI_Hs02_00333282 predicted 1560
10 SASI_Hs01_00134695 predicted 252
11 SASI_Hs01_00134690 predicted 1038
12 SASI_Hs01_00134692 predicted 916
13 SASI_Hs01_00134696 predicted 364
14 SASI_Hs01_00134697 predicted 366
15 SASI_Hs01_00134698 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195323 predicted 1027
2 SASI_Hs01_00195326 predicted 941
3 SASI_Hs01_00195324 predicted 1029
4 SASI_Hs01_00195328 predicted 945
5 SASI_Hs02_00365412 predicted 861
6 SASI_Hs02_00365413 predicted 1381
7 SASI_Hs02_00365414 predicted 1532
8 SASI_Hs02_00365415 predicted 1599
9 SASI_Hs02_00365416 predicted 1597
10 SASI_Hs02_00365417 predicted 254
11 SASI_Hs01_00195325 predicted 1063
12 SASI_Hs01_00195327 predicted 942
13 SASI_Hs01_00195329 predicted 385
14 SASI_Hs01_00195330 predicted 344
15 SASI_Hs01_00195331 predicted 1275
16 SASI_Hs01_00195332 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042122 predicted 982
2 SASI_Hs01_00042125 predicted 889
3 SASI_Hs01_00042123 predicted 986
4 SASI_Hs01_00042127 predicted 900
5 SASI_Hs02_00365418 predicted 817
6 SASI_Hs02_00365419 predicted 1337
7 SASI_Hs02_00365420 predicted 1489
8 SASI_Hs02_00365421 predicted 1563
9 SASI_Hs02_00365422 predicted 1547
10 SASI_Hs02_00365423 predicted 203
11 SASI_Hs01_00042124 predicted 1021
12 SASI_Hs01_00042126 predicted 901
13 SASI_Hs01_00042128 predicted 331
14 SASI_Hs01_00042129 predicted 298
15 SASI_Hs01_00042130 predicted 1231
16 SASI_Hs01_00042131 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186717 predicted 949
2 SASI_Hs01_00186719 predicted 860
3 SASI_Hs01_00186721 predicted 952
4 SASI_Hs01_00186722 predicted 871
5 SASI_Hs02_00365424 predicted 784
6 SASI_Hs02_00365425 predicted 293
7 SASI_Hs02_00365426 predicted 1301
8 SASI_Hs02_00365427 predicted 1529
9 SASI_Hs02_00365428 predicted 1512
10 SASI_Hs01_00186723 predicted 207
11 SASI_Hs01_00186718 predicted 986
12 SASI_Hs01_00186720 predicted 866
13 SASI_Hs01_00186724 predicted 311
14 SASI_Hs01_00186725 predicted 317
15 SASI_Hs01_00186726 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164404 predicted 876
2 SASI_Hs01_00164406 predicted 802
3 SASI_Hs01_00164411 predicted 707
4 SASI_Hs01_00164412 predicted 228
5 SASI_Hs02_00365429 predicted 1237
6 SASI_Hs02_00365430 predicted 1388
7 SASI_Hs02_00365431 predicted 1451
8 SASI_Hs02_00365432 predicted 1448
9 SASI_Hs02_00365433 predicted 1350
10 SASI_Hs01_00164407 predicted 139
11 SASI_Hs01_00164405 predicted 795
12 SASI_Hs01_00164408 predicted 251
13 SASI_Hs01_00164409 predicted 246
14 SASI_Hs01_00164410 predicted 243
15 SASI_Hs01_00164413 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219168 predicted 1088
2 SASI_Hs01_00219171 predicted 996
3 SASI_Hs01_00219169 predicted 1091
4 SASI_Hs01_00219173 predicted 1003
5 SASI_Hs02_00365434 predicted 911
6 SASI_Hs02_00365435 predicted 1440
7 SASI_Hs02_00365436 predicted 1587
8 SASI_Hs02_00365437 predicted 1659
9 SASI_Hs02_00365438 predicted 1647
10 SASI_Hs02_00365439 predicted 312
11 SASI_Hs01_00219170 predicted 1129
12 SASI_Hs01_00219172 predicted 1006
13 SASI_Hs01_00219174 predicted 440
14 SASI_Hs01_00219175 predicted 401
15 SASI_Hs01_00219176 predicted 1331
16 SASI_Hs01_00219177 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098346 predicted 956
2 SASI_Hs01_00098348 predicted 862
3 SASI_Hs01_00098350 predicted 962
4 SASI_Hs01_00098351 predicted 877
5 SASI_Hs02_00365440 predicted 788
6 SASI_Hs02_00365441 predicted 302
7 SASI_Hs02_00365442 predicted 1312
8 SASI_Hs02_00365443 predicted 1528
9 SASI_Hs02_00365444 predicted 1520
10 SASI_Hs01_00098352 predicted 209
11 SASI_Hs01_00098347 predicted 995
12 SASI_Hs01_00098349 predicted 877
13 SASI_Hs01_00098353 predicted 319
14 SASI_Hs01_00098354 predicted 328
15 SASI_Hs01_00098355 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045509 predicted 173
2 SASI_Rn01_00045510 predicted 203
3 SASI_Rn01_00045511 predicted 214
4 SASI_Rn01_00045512 predicted 204
5 SASI_Rn01_00045513 predicted 200
6 SASI_Rn01_00045514 predicted 168
7 SASI_Rn01_00045515 predicted 176
8 SASI_Rn01_00045516 predicted 211
9 SASI_Rn01_00045517 predicted 201
10 SASI_Rn02_00268569 predicted 107
11 SASI_Rn01_00045518 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108460 predicted 341
2 SASI_Mm01_00108462 predicted 293
3 SASI_Mm01_00108463 predicted 859
4 SASI_Mm01_00108464 predicted 250
5 SASI_Mm01_00108465 predicted 343
6 SASI_Mm01_00108466 predicted 417
7 SASI_Mm01_00108467 predicted 345
8 SASI_Mm01_00108468 predicted 339
9 SASI_Mm01_00108469 predicted 611
10 SASI_Mm02_00287870 predicted 307
11 SASI_Mm01_00108461 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084465 predicted 450
2 SASI_Mm01_00084468 predicted 970
3 SASI_Mm01_00084471 predicted 532
4 SASI_Mm01_00084467 predicted 402
5 SASI_Mm01_00084469 predicted 364
6 SASI_Mm01_00084470 predicted 450
7 SASI_Mm01_00084472 predicted 455
8 SASI_Mm01_00084473 predicted 456
9 SASI_Mm01_00084474 predicted 730
10 SASI_Mm02_00290017 predicted 425
11 SASI_Mm01_00084466 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156613 predicted 694
2 SASI_Mm01_00156616 predicted 1215
3 SASI_Mm01_00156619 predicted 773
4 SASI_Mm01_00156615 predicted 645
5 SASI_Mm01_00156617 predicted 604
6 SASI_Mm01_00156618 predicted 692
7 SASI_Mm01_00156620 predicted 701
8 SASI_Mm01_00156621 predicted 695
9 SASI_Mm01_00156622 predicted 970
10 SASI_Mm02_00323264 predicted 659
11 SASI_Mm01_00156614 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002131
VALIDATED
HMGA1 MISSION shRNA Bacterial Glycerol Stock
high mobility group AT-hook 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-432s21c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-419s21c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-354s21c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-519s21c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-446s1c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-359s1c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-346s1c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-281s1c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002131
VALIDATED
HMGA1 MISSION shRNA shRNA Plasmid DNA
high mobility group AT-hook 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-432s21c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-419s21c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-354s21c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-519s21c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-446s1c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-359s1c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-346s1c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-281s1c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002131
VALIDATED
HMGA1 MISSION shRNA Lentiviral Transduction Particles
high mobility group AT-hook 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-432s21c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-419s21c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-354s21c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002131.3-519s21c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-446s1c1
Sequence:CCGGCAACTCCAGGAAGGAAACCAACTCGAGTTGGTTTCCTTCCTGGAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-359s1c1
Sequence:CCGGCCAGCGAAGTGCCAACACCTACTCGAGTAGGTGTTGGCACTTCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-346s1c1
Sequence:CCGGCCTCCGAAGGAGCCCAGCGAACTCGAGTTCGCTGGGCTCCTTCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002131.2-281s1c1
Sequence:CCGGCCTTGGCCTCCAAGCAGGAAACTCGAGTTTCCTGCTTGGAGGCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016660
VALIDATED
HMGA1 MISSION shRNA Bacterial Glycerol Stock
high mobility group AT-hook 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-667s21c1
Sequence:CCGGGTGAAGTGCCAACTCCGAAGACTCGAGTCTTCGGAGTTGGCACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-747s21c1
Sequence:CCGGACCACAGCTCCAGGGAGGAAACTCGAGTTTCCTCCCTGGAGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-1689s21c1
Sequence:CCGGATTCTTAGATACCCACTATTGCTCGAGCAATAGTGGGTATCTAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-841s21c1
Sequence:CCGGAGTGATCACCACTCGCAGTGCCTCGAGGCACTGCGAGTGGTGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-700s21c1
Sequence:CCGGGACCAAAGGGAAGCAAGAATACTCGAGTATTCTTGCTTCCCTTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-432s1c1
Sequence:CCGGGAAACTGGAGAAGGAGGAAGACTCGAGTCTTCCTCCTTCTCCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-689s1c1
Sequence:CCGGCCATCCTGACAAGGCTAACTTCTCGAGAAGTTAGCCTTGTCAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-423s1c1
Sequence:CCGGCAGACCCAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTGGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1054s1c1
Sequence:CCGGCCCACTTTAATGTTCTCACCTCTCGAGAGGTGAGAACATTAAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1329s1c1
Sequence:CCGGCATTCTTAGATACCCACTATTCTCGAGAATAGTGGGTATCTAAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016660
VALIDATED
HMGA1 MISSION shRNA shRNA Plasmid DNA
high mobility group AT-hook 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-667s21c1
Sequence:CCGGGTGAAGTGCCAACTCCGAAGACTCGAGTCTTCGGAGTTGGCACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-747s21c1
Sequence:CCGGACCACAGCTCCAGGGAGGAAACTCGAGTTTCCTCCCTGGAGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-1689s21c1
Sequence:CCGGATTCTTAGATACCCACTATTGCTCGAGCAATAGTGGGTATCTAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-841s21c1
Sequence:CCGGAGTGATCACCACTCGCAGTGCCTCGAGGCACTGCGAGTGGTGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-700s21c1
Sequence:CCGGGACCAAAGGGAAGCAAGAATACTCGAGTATTCTTGCTTCCCTTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-432s1c1
Sequence:CCGGGAAACTGGAGAAGGAGGAAGACTCGAGTCTTCCTCCTTCTCCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-689s1c1
Sequence:CCGGCCATCCTGACAAGGCTAACTTCTCGAGAAGTTAGCCTTGTCAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-423s1c1
Sequence:CCGGCAGACCCAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTGGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1054s1c1
Sequence:CCGGCCCACTTTAATGTTCTCACCTCTCGAGAGGTGAGAACATTAAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1329s1c1
Sequence:CCGGCATTCTTAGATACCCACTATTCTCGAGAATAGTGGGTATCTAAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016660
VALIDATED
HMGA1 MISSION shRNA Lentiviral Transduction Particles
high mobility group AT-hook 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-667s21c1
Sequence:CCGGGTGAAGTGCCAACTCCGAAGACTCGAGTCTTCGGAGTTGGCACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-747s21c1
Sequence:CCGGACCACAGCTCCAGGGAGGAAACTCGAGTTTCCTCCCTGGAGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-1689s21c1
Sequence:CCGGATTCTTAGATACCCACTATTGCTCGAGCAATAGTGGGTATCTAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-841s21c1
Sequence:CCGGAGTGATCACCACTCGCAGTGCCTCGAGGCACTGCGAGTGGTGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016660.2-700s21c1
Sequence:CCGGGACCAAAGGGAAGCAAGAATACTCGAGTATTCTTGCTTCCCTTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-432s1c1
Sequence:CCGGGAAACTGGAGAAGGAGGAAGACTCGAGTCTTCCTCCTTCTCCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-689s1c1
Sequence:CCGGCCATCCTGACAAGGCTAACTTCTCGAGAAGTTAGCCTTGTCAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016660.1-423s1c1
Sequence:CCGGCAGACCCAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTGGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1054s1c1
Sequence:CCGGCCCACTTTAATGTTCTCACCTCTCGAGAGGTGAGAACATTAAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016660.1-1329s1c1
Sequence:CCGGCATTCTTAGATACCCACTATTCTCGAGAATAGTGGGTATCTAAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)