EMAIL THIS PAGE TO A FRIEND

HMGA2

high mobility group AT-hook 2

408 Gene Product Result for
Synonyms: BABL HMGI-C HMGIC LIPO STQTL9
UniProtKB ID: P52926, Q1M182
Gene ID:
Human(8091) Summary: This gene encodes a protein that belongs to the non-histone chromosomal high mobility group (HMG) protein family. HMG proteins function as architectural factors and are essential components of the enhancesome. This protein contains structural DNA-binding domains and may act as a transcriptional regulating factor. Identification of the deletion, amplification, and rearrangement of this gene that are associated with myxoid liposarcoma suggests a role in adipogenesis and mesenchymal differentiation. A gene knock out study of the mouse counterpart demonstrated that this gene is involved in diet-induced obesity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(15364) high mobility group AT-hook 2
Rat(84017) high mobility group AT-hook 2
Zebrafish(324428) high mobility group AT-hook 2
cow(100297155) high mobility group AT-hook 2
domestic cat(101092698) high mobility group AT-hook 2
dog(100271859) high mobility group AT-hook 2
chicken(395851) high mobility group AT-hook 2
naked mole-rat(101706197) high mobility group AT-hook 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108516 Anti-HMGA2 IgG fraction of antiserum rat, horse, rabbit, guinea pig, goat, mouse, human, zebrafish, bovine, canine, human
western blot pricing
SAB2501316 Anti-HMGA2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AV38356 Anti-HMGA2 antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, horse, zebrafish, mouse, rabbit, human, pig, rat, bovine
western blot pricing
SAB4300681 Anti-HMGA2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB2701959 Anti-HMGA2 antibody produced in rabbit human, mouse, rat
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA039076 Anti-HMGA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305516 MONOCLONAL ANTI-HMG2 antibody produced in mouse clone 523ct16.1.1, crude ascites, buffered aqueous solution human
western blot pricing
WH0008091M1 Monoclonal Anti-HMGA2 antibody produced in mouse clone 2D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404571 Monoclonal Anti-HMGA2, (N-terminal) antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_010441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196671 MISSION® esiRNA esiRNA targeting mouse Hmga2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003483 Rosetta Predictions human pricing
NM_003484 Rosetta Predictions human pricing
NM_032070 Rosetta Predictions rat pricing
NM_010441 Rosetta Predictions mouse pricing
NM_178057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098053 predicted 1563
2 SASI_Hs01_00098054 predicted 1109
3 SASI_Hs01_00098058 predicted 1578
4 SASI_Hs01_00098059 predicted 1434
5 SASI_Hs01_00098060 predicted 1437
6 SASI_Hs02_00335752 predicted 1636
7 SASI_Hs02_00335753 predicted 1313
8 SASI_Hs02_00335754 predicted 1525
9 SASI_Hs02_00335755 predicted 1544
10 SASI_Hs02_00335756 predicted 1103
11 SASI_Hs01_00098052 predicted 1397
12 SASI_Hs01_00098055 predicted 1053
13 SASI_Hs01_00098056 predicted 1200
14 SASI_Hs01_00098057 predicted 1313
15 SASI_Hs01_00098061 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013724 predicted 1176
2 SASI_Hs01_00013725 predicted 1147
3 SASI_Hs01_00013726 predicted 1116
4 SASI_Hs01_00013727 predicted 1147
5 SASI_Hs01_00013728 predicted 1179
6 SASI_Hs01_00013729 predicted 1143
7 SASI_Hs01_00013730 predicted 1190
8 SASI_Hs01_00013731 predicted 1183
9 SASI_Hs02_00335757 predicted 1443
10 SASI_Hs02_00335758 predicted 1210
11 SASI_Hs01_00013732 predicted 1189
12 SASI_Hs01_00013733 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051268 predicted 517
2 SASI_Rn01_00051269 predicted 528
3 SASI_Rn01_00051270 predicted 432
4 SASI_Rn01_00051271 predicted 509
5 SASI_Rn01_00051272 predicted 539
6 SASI_Rn01_00051273 predicted 498
7 SASI_Rn01_00051274 predicted 438
8 SASI_Rn01_00051275 predicted 527
9 SASI_Rn01_00051277 predicted 416
10 SASI_Rn02_00265428 predicted 490
11 SASI_Rn01_00051276 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108787 predicted 975
2 SASI_Mm01_00108782 predicted 986
3 SASI_Mm02_00318594 predicted 1374
4 SASI_Mm02_00318595 predicted 1267
5 SASI_Mm02_00318596 predicted 1220
6 SASI_Mm02_00318597 predicted 1554
7 SASI_Mm02_00318598 predicted 1627
8 SASI_Mm02_00318599 predicted 1371
9 SASI_Mm02_00318600 predicted 1359
10 SASI_Mm02_00318601 predicted 1159
11 SASI_Mm01_00108783 predicted 1011
12 SASI_Mm01_00108784 predicted 1020
13 SASI_Mm01_00108785 predicted 1029
14 SASI_Mm01_00108786 predicted 1082
15 SASI_Mm01_00108788 predicted 1015
16 SASI_Mm01_00108789 predicted 982
17 SASI_Mm01_00108790 predicted 1079
18 SASI_Mm01_00108791 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118692 predicted 319
2 SASI_Mm01_00118693 predicted 313
3 SASI_Mm01_00118694 predicted 322
4 SASI_Mm01_00118695 predicted 337
5 SASI_Mm01_00118696 predicted 384
6 SASI_Mm01_00118697 predicted 302
7 SASI_Mm01_00118698 predicted 318
8 SASI_Mm01_00118699 predicted 290
9 SASI_Mm01_00118700 predicted 382
10 SASI_Mm01_00118701 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003483
VALIDATED
HMGA2 MISSION shRNA Bacterial Glycerol Stock
high mobility group AT-hook 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003483.3-3037s1c1
Sequence:CCGGCCAACCTTCAAAGAACTTGAACTCGAGTTCAAGTTCTTTGAAGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1108s1c1
Sequence:CCGGGCCACAACAAGTTGTTCAGAACTCGAGTTCTGAACAACTTGTTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1034s1c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1140s1c1
Sequence:CCGGAGGAGGAAACTGAAGAGACATCTCGAGATGTCTCTTCAGTTTCCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003483.3-1160s1c1
Sequence:CCGGTCCTCACAAGAGTCTGCCGAACTCGAGTTCGGCAGACTCTTGTGAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003483.4-1037s21c1
Sequence:CCGGCCAAGAGGCAGACCTAGGAAACTCGAGTTTCCTAGGTCTGCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-986s21c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1080s21c1
Sequence:CCGGAGAAGCCTGCTCAGGAGGAAACTCGAGTTTCCTCCTGAGCAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1491s21c1
Sequence:CCGGCCGAATTGGGTTTAGTCAATCCTCGAGGATTGACTAAACCCAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1114s21c1
Sequence:CCGGCTCACAAGAGTCTGCCGAAGACTCGAGTCTTCGGCAGACTCTTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003483
VALIDATED
HMGA2 MISSION shRNA shRNA Plasmid DNA
high mobility group AT-hook 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003483.3-3037s1c1
Sequence:CCGGCCAACCTTCAAAGAACTTGAACTCGAGTTCAAGTTCTTTGAAGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1108s1c1
Sequence:CCGGGCCACAACAAGTTGTTCAGAACTCGAGTTCTGAACAACTTGTTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1034s1c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1140s1c1
Sequence:CCGGAGGAGGAAACTGAAGAGACATCTCGAGATGTCTCTTCAGTTTCCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003483.3-1160s1c1
Sequence:CCGGTCCTCACAAGAGTCTGCCGAACTCGAGTTCGGCAGACTCTTGTGAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003483.4-1037s21c1
Sequence:CCGGCCAAGAGGCAGACCTAGGAAACTCGAGTTTCCTAGGTCTGCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-986s21c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1080s21c1
Sequence:CCGGAGAAGCCTGCTCAGGAGGAAACTCGAGTTTCCTCCTGAGCAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1491s21c1
Sequence:CCGGCCGAATTGGGTTTAGTCAATCCTCGAGGATTGACTAAACCCAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1114s21c1
Sequence:CCGGCTCACAAGAGTCTGCCGAAGACTCGAGTCTTCGGCAGACTCTTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003483
VALIDATED
HMGA2 MISSION shRNA Lentiviral Transduction Particles
high mobility group AT-hook 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003483.3-3037s1c1
Sequence:CCGGCCAACCTTCAAAGAACTTGAACTCGAGTTCAAGTTCTTTGAAGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1108s1c1
Sequence:CCGGGCCACAACAAGTTGTTCAGAACTCGAGTTCTGAACAACTTGTTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1034s1c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003483.3-1140s1c1
Sequence:CCGGAGGAGGAAACTGAAGAGACATCTCGAGATGTCTCTTCAGTTTCCTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003483.3-1160s1c1
Sequence:CCGGTCCTCACAAGAGTCTGCCGAACTCGAGTTCGGCAGACTCTTGTGAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003483.4-1037s21c1
Sequence:CCGGCCAAGAGGCAGACCTAGGAAACTCGAGTTTCCTAGGTCTGCCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-986s21c1
Sequence:CCGGAGTCCCTCTAAAGCAGCTCAACTCGAGTTGAGCTGCTTTAGAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1080s21c1
Sequence:CCGGAGAAGCCTGCTCAGGAGGAAACTCGAGTTTCCTCCTGAGCAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1491s21c1
Sequence:CCGGCCGAATTGGGTTTAGTCAATCCTCGAGGATTGACTAAACCCAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003483.4-1114s21c1
Sequence:CCGGCTCACAAGAGTCTGCCGAAGACTCGAGTCTTCGGCAGACTCTTGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178057
HMGA2 MISSION shRNA Bacterial Glycerol Stock
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178057.2-1304s1c1
Sequence:CCGGCGGGAAATCTACACAGCCAAACTCGAGTTTGGCTGTGTAGATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-451s1c1
Sequence:CCGGGCCACAACAAGTCGTTCAGAACTCGAGTTCTGAACGACTTGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-437s1c1
Sequence:CCGGAGACCTAGGAAATGGCCACAACTCGAGTTGTGGCCATTTCCTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-488s1c1
Sequence:CCGGACTGAAGAGACATCCTCGCAACTCGAGTTGCGAGGATGTCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-329s1c1
Sequence:CCGGCCCTCTCCTAAGAGACCCAGACTCGAGTCTGGGTCTCTTAGGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178057
HMGA2 MISSION shRNA shRNA Plasmid DNA
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178057.2-1304s1c1
Sequence:CCGGCGGGAAATCTACACAGCCAAACTCGAGTTTGGCTGTGTAGATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-451s1c1
Sequence:CCGGGCCACAACAAGTCGTTCAGAACTCGAGTTCTGAACGACTTGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-437s1c1
Sequence:CCGGAGACCTAGGAAATGGCCACAACTCGAGTTGTGGCCATTTCCTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-488s1c1
Sequence:CCGGACTGAAGAGACATCCTCGCAACTCGAGTTGCGAGGATGTCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-329s1c1
Sequence:CCGGCCCTCTCCTAAGAGACCCAGACTCGAGTCTGGGTCTCTTAGGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178057
HMGA2 MISSION shRNA Lentiviral Transduction Particles
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178057.2-1304s1c1
Sequence:CCGGCGGGAAATCTACACAGCCAAACTCGAGTTTGGCTGTGTAGATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-451s1c1
Sequence:CCGGGCCACAACAAGTCGTTCAGAACTCGAGTTCTGAACGACTTGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-437s1c1
Sequence:CCGGAGACCTAGGAAATGGCCACAACTCGAGTTGTGGCCATTTCCTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-488s1c1
Sequence:CCGGACTGAAGAGACATCCTCGCAACTCGAGTTGCGAGGATGTCTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178057.2-329s1c1
Sequence:CCGGCCCTCTCCTAAGAGACCCAGACTCGAGTCTGGGTCTCTTAGGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010441
HMGA2 MISSION shRNA Bacterial Glycerol Stock
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1132s21c1
Sequence:CCGGTCGTTCAGAAGAAGCCTGCTCCTCGAGGAGCAGGCTTCTTCTGAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1145s21c1
Sequence:CCGGGCCTGCTCAGGAGACTGAAGACTCGAGTCTTCAGTCTCCTGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1011s21c1
Sequence:CCGGAGACCCAGAGGAAGACCCAAACTCGAGTTTGGGTCTTCCTCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010441.2-3991s21c1
Sequence:CCGGGAAACTTATCAAGACGATTAACTCGAGTTAATCGTCTTGATAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1179s21c1
Sequence:CCGGGAGTCCGCAGAGGAGGATTAGCTCGAGCTAATCCTCCTCTGCGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010441
HMGA2 MISSION shRNA shRNA Plasmid DNA
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1132s21c1
Sequence:CCGGTCGTTCAGAAGAAGCCTGCTCCTCGAGGAGCAGGCTTCTTCTGAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1145s21c1
Sequence:CCGGGCCTGCTCAGGAGACTGAAGACTCGAGTCTTCAGTCTCCTGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1011s21c1
Sequence:CCGGAGACCCAGAGGAAGACCCAAACTCGAGTTTGGGTCTTCCTCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010441.2-3991s21c1
Sequence:CCGGGAAACTTATCAAGACGATTAACTCGAGTTAATCGTCTTGATAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1179s21c1
Sequence:CCGGGAGTCCGCAGAGGAGGATTAGCTCGAGCTAATCCTCCTCTGCGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010441
HMGA2 MISSION shRNA Lentiviral Transduction Particles
high mobility group AT-hook 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1132s21c1
Sequence:CCGGTCGTTCAGAAGAAGCCTGCTCCTCGAGGAGCAGGCTTCTTCTGAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1145s21c1
Sequence:CCGGGCCTGCTCAGGAGACTGAAGACTCGAGTCTTCAGTCTCCTGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1011s21c1
Sequence:CCGGAGACCCAGAGGAAGACCCAAACTCGAGTTTGGGTCTTCCTCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010441.2-3991s21c1
Sequence:CCGGGAAACTTATCAAGACGATTAACTCGAGTTAATCGTCTTGATAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010441.2-1179s21c1
Sequence:CCGGGAGTCCGCAGAGGAGGATTAGCTCGAGCTAATCCTCCTCTGCGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)