EMAIL THIS PAGE TO A FRIEND

HMGB1

high mobility group box 1

147 Gene Product Result for
Synonyms: HMG1 HMG3 SBP-1
UniProtKB ID: P09429, A5D8W9, Q14321, Q5T7C3, Q6IBE1
Gene ID:
Mouse(15289) high mobility group box 1
Rat(25459) high mobility group box 1
Domestic Rabbit(100328641) high mobility group box 1
naked mole-rat(101705428) high mobility group box 1
Thale Cress(824351) high mobility group protein B1
cow(282691) high mobility group box 1
Horse(100033873) high mobility group box 1
domestic cat(101089823) high mobility group box 1
dog(403170) high mobility group box 1
chicken(395724) high mobility group box 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301776 ANTI-HMG1L10 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2108502 Anti-HMGB1 IgG fraction of antiserum mouse, bovine, guinea pig, rat, dog, human, rabbit, horse
western blot pricing
SAB2108675 Anti-HMGB1 affinity isolated antibody dog, human, guinea pig, mouse, rabbit, horse, rat, bovine
western blot pricing
AV35646 Anti-HMGB1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, mouse, canine, pig, bovine, human, rat, guinea pig, rabbit
western blot pricing
AV38110 Anti-HMGB1 (AB2) antibody produced in rabbit IgG fraction of antiserum human, bovine, horse, dog, rabbit, mouse, rat, guinea pig
western blot pricing
H9539 Anti-HMGB1 (HMG1) (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunofluorescence, immunoprecipitation (IP), western blot pricing
H9664 Anti-HMGB1 (HMG1) (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2101049 Anti-HMGB1 antibody produced in rabbit affinity isolated antibody mouse, human, bovine, horse, canine, rat, rabbit, pig, guinea pig
western blot pricing
SAB4501401 Anti-HMGB1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
H9537 Monoclonal Anti-HMG-1 antibody produced in mouse clone HAP46.5, purified from hybridoma cell culture rat, chicken, mouse, canine, human
ELISA, microarray, western blot pricing
WH0003146M8 Monoclonal Anti-HMGB1 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403925 Monoclonal Anti-HMGB1 antibody produced in mouse clone 1D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002128 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002128 Rosetta Predictions human pricing
XM_001072913 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196036 predicted 359
2 SASI_Hs01_00196037 predicted 362
3 SASI_Hs01_00196038 predicted 1161
4 SASI_Hs01_00196039 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340918 predicted 273
2 SASI_Rn02_00340919 predicted 302
3 SASI_Rn02_00340920 predicted 1257
4 SASI_Rn02_00340921 predicted 1231
5 SASI_Rn02_00340922 predicted 1185
6 SASI_Rn02_00340923 predicted 309
7 SASI_Rn02_00340924 predicted 1047
8 SASI_Rn02_00340925 predicted 765
9 SASI_Rn02_00340926 predicted 11
10 SASI_Rn02_00340927 predicted 107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010439
VALIDATED
HMGB1 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1067s21c1
Sequence:CCGGTTGGTGCACAGCACAAATTAGCTCGAGCTAATTTGTGCTGTGCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-298s21c1
Sequence:CCGGGGAAGACCATGTCTGCTAAAGCTCGAGCTTTAGCAGACATGGTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-350s21c1
Sequence:CCGGTGACAAGGCTCGTTATGAAAGCTCGAGCTTTCATAACGAGCCTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1184s21c1
Sequence:CCGGATGCAGCTTATACGAAGATAACTCGAGTTATCTTCGTATAAGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-780s21c1
Sequence:CCGGGAAGATGATGATGATGAATAACTCGAGTTATTCATCATCATCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-247s21c1
Sequence:CCGGCGGATGCTTCTGTCAACTTCTCTCGAGAGAAGTTGACAGAAGCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-598s1c1
Sequence:CCGGGCCAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-505s1c1
Sequence:CCGGCCTGGCTTATCCATTGGTGATCTCGAGATCACCAATGGATAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-610s1c1
Sequence:CCGGGAGAAGTATGAGAAGGATATTCTCGAGAATATCCTTCTCATACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-452s1c1
Sequence:CCGGCGGCCTTCTTCTTGTTCTGTTCTCGAGAACAGAACAAGAAGAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-567s21c1
Sequence:CCGGGATGACAAGCAGCCCTATGAGCTCGAGCTCATAGGGCTGCTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010439.2-1964s1c1
Sequence:CCGGCCCTTTATGAATCAGATACAACTCGAGTTGTATCTGATTCATAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010439
VALIDATED
HMGB1 MISSION shRNA shRNA Plasmid DNA
high mobility group box 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1067s21c1
Sequence:CCGGTTGGTGCACAGCACAAATTAGCTCGAGCTAATTTGTGCTGTGCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-298s21c1
Sequence:CCGGGGAAGACCATGTCTGCTAAAGCTCGAGCTTTAGCAGACATGGTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-350s21c1
Sequence:CCGGTGACAAGGCTCGTTATGAAAGCTCGAGCTTTCATAACGAGCCTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1184s21c1
Sequence:CCGGATGCAGCTTATACGAAGATAACTCGAGTTATCTTCGTATAAGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-780s21c1
Sequence:CCGGGAAGATGATGATGATGAATAACTCGAGTTATTCATCATCATCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-247s21c1
Sequence:CCGGCGGATGCTTCTGTCAACTTCTCTCGAGAGAAGTTGACAGAAGCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-598s1c1
Sequence:CCGGGCCAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-505s1c1
Sequence:CCGGCCTGGCTTATCCATTGGTGATCTCGAGATCACCAATGGATAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-610s1c1
Sequence:CCGGGAGAAGTATGAGAAGGATATTCTCGAGAATATCCTTCTCATACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-452s1c1
Sequence:CCGGCGGCCTTCTTCTTGTTCTGTTCTCGAGAACAGAACAAGAAGAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-567s21c1
Sequence:CCGGGATGACAAGCAGCCCTATGAGCTCGAGCTCATAGGGCTGCTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010439.2-1964s1c1
Sequence:CCGGCCCTTTATGAATCAGATACAACTCGAGTTGTATCTGATTCATAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010439
VALIDATED
HMGB1 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1067s21c1
Sequence:CCGGTTGGTGCACAGCACAAATTAGCTCGAGCTAATTTGTGCTGTGCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-298s21c1
Sequence:CCGGGGAAGACCATGTCTGCTAAAGCTCGAGCTTTAGCAGACATGGTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-350s21c1
Sequence:CCGGTGACAAGGCTCGTTATGAAAGCTCGAGCTTTCATAACGAGCCTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-1184s21c1
Sequence:CCGGATGCAGCTTATACGAAGATAACTCGAGTTATCTTCGTATAAGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-780s21c1
Sequence:CCGGGAAGATGATGATGATGAATAACTCGAGTTATTCATCATCATCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-247s21c1
Sequence:CCGGCGGATGCTTCTGTCAACTTCTCTCGAGAGAAGTTGACAGAAGCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-598s1c1
Sequence:CCGGGCCAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010439.2-505s1c1
Sequence:CCGGCCTGGCTTATCCATTGGTGATCTCGAGATCACCAATGGATAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-610s1c1
Sequence:CCGGGAGAAGTATGAGAAGGATATTCTCGAGAATATCCTTCTCATACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010439.2-452s1c1
Sequence:CCGGCGGCCTTCTTCTTGTTCTGTTCTCGAGAACAGAACAAGAAGAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010439.3-567s21c1
Sequence:CCGGGATGACAAGCAGCCCTATGAGCTCGAGCTCATAGGGCTGCTTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010439.2-1964s1c1
Sequence:CCGGCCCTTTATGAATCAGATACAACTCGAGTTGTATCTGATTCATAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002128
VALIDATED
HMGB1 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002128.4-1142s21c1
Sequence:CCGGGATGCAGCTTATACGAAATAACTCGAGTTATTTCGTATAAGCTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-638s21c1
Sequence:CCGGATTGCTGCATATCGAGCTAAACTCGAGTTTAGCTCGATATGCAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002128.3-1783s1c1
Sequence:CCGGCGAGACTTTCATTACAAGTATCTCGAGATACTTGTAATGAAAGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-702s1c1
Sequence:CCGGGAAGAAGATGAAGATGAAGAACTCGAGTTCTTCATCTTCATCTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-302s1c1
Sequence:CCGGCCGTTATGAAAGAGAAATGAACTCGAGTTCATTTCTCTTTCATAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002128.3-507s1c1
Sequence:CCGGGCAGATGACAAGCAGCCTTATCTCGAGATAAGGCTGCTTGTCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-528s21c1
Sequence:CCGGTTGGTGATGTTGCGAAGAAACCTCGAGGTTTCTTCGCAACATCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-188s1c1
Sequence:CCGGCCCAGATGCTTCAGTCAACTTCTCGAGAAGTTGACTGAAGCATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002128
VALIDATED
HMGB1 MISSION shRNA shRNA Plasmid DNA
high mobility group box 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002128.4-1142s21c1
Sequence:CCGGGATGCAGCTTATACGAAATAACTCGAGTTATTTCGTATAAGCTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-638s21c1
Sequence:CCGGATTGCTGCATATCGAGCTAAACTCGAGTTTAGCTCGATATGCAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002128.3-1783s1c1
Sequence:CCGGCGAGACTTTCATTACAAGTATCTCGAGATACTTGTAATGAAAGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-702s1c1
Sequence:CCGGGAAGAAGATGAAGATGAAGAACTCGAGTTCTTCATCTTCATCTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-302s1c1
Sequence:CCGGCCGTTATGAAAGAGAAATGAACTCGAGTTCATTTCTCTTTCATAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002128.3-507s1c1
Sequence:CCGGGCAGATGACAAGCAGCCTTATCTCGAGATAAGGCTGCTTGTCATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-528s21c1
Sequence:CCGGTTGGTGATGTTGCGAAGAAACCTCGAGGTTTCTTCGCAACATCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-188s1c1
Sequence:CCGGCCCAGATGCTTCAGTCAACTTCTCGAGAAGTTGACTGAAGCATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002128
VALIDATED
HMGB1 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002128.4-1142s21c1
Sequence:CCGGGATGCAGCTTATACGAAATAACTCGAGTTATTTCGTATAAGCTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-638s21c1
Sequence:CCGGATTGCTGCATATCGAGCTAAACTCGAGTTTAGCTCGATATGCAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002128.3-1783s1c1
Sequence:CCGGCGAGACTTTCATTACAAGTATCTCGAGATACTTGTAATGAAAGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-702s1c1
Sequence:CCGGGAAGAAGATGAAGATGAAGAACTCGAGTTCTTCATCTTCATCTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-302s1c1
Sequence:CCGGCCGTTATGAAAGAGAAATGAACTCGAGTTCATTTCTCTTTCATAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002128.3-507s1c1
Sequence:CCGGGCAGATGACAAGCAGCCTTATCTCGAGATAAGGCTGCTTGTCATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002128.4-528s21c1
Sequence:CCGGTTGGTGATGTTGCGAAGAAACCTCGAGGTTTCTTCGCAACATCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002128.3-188s1c1
Sequence:CCGGCCCAGATGCTTCAGTCAACTTCTCGAGAAGTTGACTGAAGCATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)