EMAIL THIS PAGE TO A FRIEND

HMGB1P1

high mobility group box 1 pseudogene 1

9 Gene Product Result for
Synonyms: HMG1L1 HMG1L7 HMGB1L1 dJ579F20.1
UniProtKB ID: B2RPK0
Gene ID:
cow(100301168) high-mobility group box 1 pseudogene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008735 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111089 predicted 202
2 SASI_Hs01_00111091 predicted 197
3 SASI_Hs01_00111092 predicted 199
4 SASI_Hs01_00111093 predicted 208
5 SASI_Hs01_00111094 predicted 193
6 SASI_Hs01_00111090 predicted 202
7 SASI_Hs01_00111095 predicted 191
8 SASI_Hs01_00111096 predicted 196
9 SASI_Hs01_00111097 predicted 189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008735
HMGB1P1 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-196s1c1
Sequence:CCGGGCGGACAAGACCCATTATGAACTCGAGTTCATAATGGGTCTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-315s1c1
Sequence:CCGGCTGCTCTGAGTATCACCCAAACTCGAGTTTGGGTGATACTCAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-479s1c1
Sequence:CCGGCTGCATATCAAGCTAAAGGAACTCGAGTTCCTTTAGCTTGATATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-90s1c1
Sequence:CCGGGCACTCAGATGCTTCAGTCAACTCGAGTTGACTGAAGCATCTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-486s1c1
Sequence:CCGGTCAAGCTAAAGGAAAGCCTGACTCGAGTCAGGCTTTCCTTTAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008735
HMGB1P1 MISSION shRNA shRNA Plasmid DNA
high mobility group box 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-196s1c1
Sequence:CCGGGCGGACAAGACCCATTATGAACTCGAGTTCATAATGGGTCTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-315s1c1
Sequence:CCGGCTGCTCTGAGTATCACCCAAACTCGAGTTTGGGTGATACTCAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-479s1c1
Sequence:CCGGCTGCATATCAAGCTAAAGGAACTCGAGTTCCTTTAGCTTGATATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-90s1c1
Sequence:CCGGGCACTCAGATGCTTCAGTCAACTCGAGTTGACTGAAGCATCTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-486s1c1
Sequence:CCGGTCAAGCTAAAGGAAAGCCTGACTCGAGTCAGGCTTTCCTTTAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008735
HMGB1P1 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-196s1c1
Sequence:CCGGGCGGACAAGACCCATTATGAACTCGAGTTCATAATGGGTCTTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-315s1c1
Sequence:CCGGCTGCTCTGAGTATCACCCAAACTCGAGTTTGGGTGATACTCAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-479s1c1
Sequence:CCGGCTGCATATCAAGCTAAAGGAACTCGAGTTCCTTTAGCTTGATATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-90s1c1
Sequence:CCGGGCACTCAGATGCTTCAGTCAACTCGAGTTGACTGAAGCATCTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008735.1-486s1c1
Sequence:CCGGTCAAGCTAAAGGAAAGCCTGACTCGAGTCAGGCTTTCCTTTAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)