EMAIL THIS PAGE TO A FRIEND

HMGB2

high mobility group box 2

116 Gene Product Result for
Synonyms: HMG2
UniProtKB ID: P26583, B2R4K8, D3DP37, Q5U072
Gene ID:
Human(3148) Summary: This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008]
Mouse(97165) high mobility group box 2
Rat(29395) high mobility group box 2
Thale Cress(838658) high mobility group B2 protein
chicken(396482) high mobility group box 2
dog(486068) high mobility group box 2
cow(540444) high mobility group box 2
domestic cat(101088835) high mobility group box 2
sheep(101120892) high mobility group box 2
domestic guinea pig(100727388) high mobility group box 2
naked mole-rat(101709633) high mobility group box 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9789 Anti-HMGB2 (HMG2) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412311 ANTI-HMGB2 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412391 ANTI-HMGB2 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107878 Anti-HMGB2 antibody produced in rabbit affinity isolated antibody guinea pig, rat, canine, mouse, bovine, human, zebrafish, horse, rabbit, pig
immunohistochemistry, western blot pricing
HPA003506 Anti-HMGB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2101050 Anti-HMGB2 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, pig, rabbit, bovine, human, horse, rat, canine
western blot pricing
HPA053314 Anti-HMGB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502080 Anti-HMGB2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0003148M5 Monoclonal Anti-HMGB2 antibody produced in mouse clone 3E5, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403926 Monoclonal Anti-HMGB2 antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002129 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_008252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105871 MISSION® esiRNA esiRNA human HMGB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002129 Rosetta Predictions human pricing
NM_017187 Rosetta Predictions rat pricing
NM_008252 Rosetta Predictions mouse pricing
XM_001052174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333274 predicted 485
2 SASI_Hs01_00017264 predicted 292
3 SASI_Hs01_00017265 predicted 398
4 SASI_Hs01_00017266 predicted 354
5 SASI_Hs01_00017267 predicted 391
6 SASI_Hs01_00017268 predicted 390
7 SASI_Hs01_00017271 predicted 347
8 SASI_Hs01_00017272 predicted 497
9 SASI_Hs01_00017273 predicted 284
10 SASI_Hs02_00333275 predicted 378
11 SASI_Hs01_00017269 predicted 484
12 SASI_Hs01_00017270 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261524 predicted 266
2 SASI_Rn02_00261525 predicted 265
3 SASI_Rn02_00261526 predicted 469
4 SASI_Rn02_00261527 predicted 468
5 SASI_Rn02_00261528 predicted 468
6 SASI_Rn02_00261529 predicted 375
7 SASI_Rn02_00261530 predicted 357
8 SASI_Rn02_00261531 predicted 349
9 SASI_Rn02_00261532 predicted 373
10 SASI_Rn02_00261533 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061383 predicted 368
2 SASI_Mm01_00061376 predicted 238
3 SASI_Mm01_00061384 predicted 372
4 SASI_Mm02_00313447 predicted 352
5 SASI_Mm02_00313448 predicted 315
6 SASI_Mm02_00313449 predicted 350
7 SASI_Mm01_00061377 predicted 257
8 SASI_Mm02_00313450 predicted 358
9 SASI_Mm01_00061378 predicted 244
10 SASI_Mm01_00061379 predicted 244
11 SASI_Mm01_00061380 predicted 258
12 SASI_Mm01_00061381 predicted 252
13 SASI_Mm01_00061382 predicted 247
14 SASI_Mm01_00061385 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214556 predicted 449
2 SASI_Mm01_00214557 predicted 430
3 SASI_Mm01_00214558 predicted 455
4 SASI_Mm01_00214559 predicted 442
5 SASI_Mm01_00214560 predicted 518
6 SASI_Mm01_00214561 predicted 518
7 SASI_Mm01_00214562 predicted 436
8 SASI_Mm01_00214563 predicted 423
9 SASI_Mm01_00214564 predicted 437
10 SASI_Mm01_00214565 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002129
VALIDATED
HMGB2 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-902s1c1
Sequence:CCGGGCTCAATACTAGCTTCAGTATCTCGAGATACTGAAGCTAGTATTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-350s1c1
Sequence:CCGGGCAAAGGAGAAGTCGAAGTTTCTCGAGAAACTTCGACTTCTCCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-632s1c1
Sequence:CCGGGCAGCTAAGCTAAAGGAGAAACTCGAGTTTCTCCTTTAGCTTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-485s1c1
Sequence:CCGGCCATCTGCCTTCTTCCTGTTTCTCGAGAAACAGGAAGAAGGCAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002129.2-602s1c1
Sequence:CCGGGCCAAAGATAAACAACCATATCTCGAGATATGGTTGTTTATCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-858s21c1
Sequence:CCGGGTGTGTGCTCAGGCAATTATTCTCGAGAATAATTGCCTGAGCACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-230s21c1
Sequence:CCGGATGTCCTCGTACGCCTTCTTCCTCGAGGAAGAAGGCGTACGAGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-427s21c1
Sequence:CCGGCGTTCCTCCCAAAGGTGATAACTCGAGTTATCACCTTTGGGAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-817s21c1
Sequence:CCGGAGAATAAATGGCTATCCTTTACTCGAGTAAAGGATAGCCATTTATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-539s21c1
Sequence:CCGGGAACACCCTGGCCTATCCATTCTCGAGAATGGATAGGCCAGGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-1311s21c1
Sequence:CCGGAGACACAGTTGACCTAGTAAACTCGAGTTTACTAGGTCAACTGTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002129
VALIDATED
HMGB2 MISSION shRNA shRNA Plasmid DNA
high mobility group box 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-902s1c1
Sequence:CCGGGCTCAATACTAGCTTCAGTATCTCGAGATACTGAAGCTAGTATTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-350s1c1
Sequence:CCGGGCAAAGGAGAAGTCGAAGTTTCTCGAGAAACTTCGACTTCTCCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-632s1c1
Sequence:CCGGGCAGCTAAGCTAAAGGAGAAACTCGAGTTTCTCCTTTAGCTTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-485s1c1
Sequence:CCGGCCATCTGCCTTCTTCCTGTTTCTCGAGAAACAGGAAGAAGGCAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002129.2-602s1c1
Sequence:CCGGGCCAAAGATAAACAACCATATCTCGAGATATGGTTGTTTATCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-858s21c1
Sequence:CCGGGTGTGTGCTCAGGCAATTATTCTCGAGAATAATTGCCTGAGCACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-230s21c1
Sequence:CCGGATGTCCTCGTACGCCTTCTTCCTCGAGGAAGAAGGCGTACGAGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-427s21c1
Sequence:CCGGCGTTCCTCCCAAAGGTGATAACTCGAGTTATCACCTTTGGGAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-817s21c1
Sequence:CCGGAGAATAAATGGCTATCCTTTACTCGAGTAAAGGATAGCCATTTATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-539s21c1
Sequence:CCGGGAACACCCTGGCCTATCCATTCTCGAGAATGGATAGGCCAGGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-1311s21c1
Sequence:CCGGAGACACAGTTGACCTAGTAAACTCGAGTTTACTAGGTCAACTGTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002129
VALIDATED
HMGB2 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-902s1c1
Sequence:CCGGGCTCAATACTAGCTTCAGTATCTCGAGATACTGAAGCTAGTATTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-350s1c1
Sequence:CCGGGCAAAGGAGAAGTCGAAGTTTCTCGAGAAACTTCGACTTCTCCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002129.2-632s1c1
Sequence:CCGGGCAGCTAAGCTAAAGGAGAAACTCGAGTTTCTCCTTTAGCTTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002129.2-485s1c1
Sequence:CCGGCCATCTGCCTTCTTCCTGTTTCTCGAGAAACAGGAAGAAGGCAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002129.2-602s1c1
Sequence:CCGGGCCAAAGATAAACAACCATATCTCGAGATATGGTTGTTTATCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-858s21c1
Sequence:CCGGGTGTGTGCTCAGGCAATTATTCTCGAGAATAATTGCCTGAGCACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-230s21c1
Sequence:CCGGATGTCCTCGTACGCCTTCTTCCTCGAGGAAGAAGGCGTACGAGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-427s21c1
Sequence:CCGGCGTTCCTCCCAAAGGTGATAACTCGAGTTATCACCTTTGGGAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-817s21c1
Sequence:CCGGAGAATAAATGGCTATCCTTTACTCGAGTAAAGGATAGCCATTTATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002129.3-539s21c1
Sequence:CCGGGAACACCCTGGCCTATCCATTCTCGAGAATGGATAGGCCAGGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002129.3-1311s21c1
Sequence:CCGGAGACACAGTTGACCTAGTAAACTCGAGTTTACTAGGTCAACTGTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486109
HMGB2 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486109.1-885s1c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-592s1c1
Sequence:CCGGGCCAAAGATAAACAACCGTATCTCGAGATACGGTTGTTTATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-305s1c1
Sequence:CCGGCCAAGAAATGCTCCGAGAGATCTCGAGATCTCTCGGAGCATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-787s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-625s1c1
Sequence:CCGGGCTAAACTAAAGGAGAAGTATCTCGAGATACTTCTCCTTTAGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486109
HMGB2 MISSION shRNA shRNA Plasmid DNA
high mobility group box 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486109.1-885s1c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-592s1c1
Sequence:CCGGGCCAAAGATAAACAACCGTATCTCGAGATACGGTTGTTTATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-305s1c1
Sequence:CCGGCCAAGAAATGCTCCGAGAGATCTCGAGATCTCTCGGAGCATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-787s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-625s1c1
Sequence:CCGGGCTAAACTAAAGGAGAAGTATCTCGAGATACTTCTCCTTTAGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486109
HMGB2 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486109.1-885s1c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-592s1c1
Sequence:CCGGGCCAAAGATAAACAACCGTATCTCGAGATACGGTTGTTTATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-305s1c1
Sequence:CCGGCCAAGAAATGCTCCGAGAGATCTCGAGATCTCTCGGAGCATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-787s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486109.1-625s1c1
Sequence:CCGGGCTAAACTAAAGGAGAAGTATCTCGAGATACTTCTCCTTTAGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008252
VALIDATED
HMGB2 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-761s21c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-859s21c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-348s21c1
Sequence:CCGGAGAGCGACAAAGCTCGTTATGCTCGAGCATAACGAGCTTTGTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-519s21c1
Sequence:CCGGTTGGAGATACTGCGAAGAAACCTCGAGGTTTCTTCGCAGTATCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-682s21c1
Sequence:CCGGTAGGCCAACAGGCTCAAAGAACTCGAGTTCTTTGAGCCTGTTGGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008252
VALIDATED
HMGB2 MISSION shRNA shRNA Plasmid DNA
high mobility group box 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-761s21c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-859s21c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-348s21c1
Sequence:CCGGAGAGCGACAAAGCTCGTTATGCTCGAGCATAACGAGCTTTGTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-519s21c1
Sequence:CCGGTTGGAGATACTGCGAAGAAACCTCGAGGTTTCTTCGCAGTATCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-682s21c1
Sequence:CCGGTAGGCCAACAGGCTCAAAGAACTCGAGTTCTTTGAGCCTGTTGGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008252
VALIDATED
HMGB2 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-761s21c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-859s21c1
Sequence:CCGGGCTCAACATTAGCTTCAGTATCTCGAGATACTGAAGCTAATGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-348s21c1
Sequence:CCGGAGAGCGACAAAGCTCGTTATGCTCGAGCATAACGAGCTTTGTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-519s21c1
Sequence:CCGGTTGGAGATACTGCGAAGAAACCTCGAGGTTTCTTCGCAGTATCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008252.2-682s21c1
Sequence:CCGGTAGGCCAACAGGCTCAAAGAACTCGAGTTCTTTGAGCCTGTTGGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)