EMAIL THIS PAGE TO A FRIEND

HMGB3

high mobility group box 3

174 Gene Product Result for
Synonyms: HMG-2a HMG-4 HMG2A HMG4
UniProtKB ID: O15347, O95556, Q6NS40
Gene ID:
Human(3149) Summary: HMGB3 belongs to the high mobility group (HMG) protein superfamily. Like HMG1 (MIM 163905) and HMG2 (MIM 163906), HMGB3 contains DNA-binding HMG box domains and is classified into the HMG box subfamily. Members of the HMG box subfamily are thought to play a fundamental role in DNA replication, nucleosome assembly and transcription (Wilke et al., 1997 [PubMed 9370291]
Mouse(15354) high mobility group box 3
Rat(305373) high mobility group box 3
Thale Cress(838659) high mobility group B3 protein
chicken(396232) high mobility group box 3
dog(481073) high mobility group box 3
cow(613729) high mobility group box 3
domestic cat(101094331) high mobility group box 3
domestic guinea pig(100723306) high mobility group box 3
sheep(101107173) high mobility group box 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005342 Rosetta Predictions human pricing
XM_001067329 Rosetta Predictions rat pricing
XM_223440 Rosetta Predictions rat pricing
NM_008253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061222 predicted 891
2 SASI_Hs01_00061224 predicted 286
3 SASI_Hs01_00061225 predicted 288
4 SASI_Hs01_00061226 predicted 750
5 SASI_Hs01_00061227 predicted 894
6 SASI_Hs01_00061229 predicted 581
7 SASI_Hs02_00339420 predicted 153
8 SASI_Hs02_00339421 predicted 749
9 SASI_Hs02_00339422 predicted 899
10 SASI_Hs01_00061228 predicted 594
11 SASI_Hs01_00061221 predicted 258
12 SASI_Hs01_00061223 predicted 234
13 SASI_Hs01_00061230 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320700 predicted 1180
2 SASI_Rn02_00320701 predicted 1066
3 SASI_Rn02_00320702 predicted 385
4 SASI_Rn02_00320703 predicted 696
5 SASI_Rn02_00320704 predicted 438
6 SASI_Rn02_00320705 predicted 369
7 SASI_Rn02_00320706 predicted 1282
8 SASI_Rn02_00320707 predicted 1244
9 SASI_Rn02_00320708 predicted 377
10 SASI_Rn02_00320709 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381381 predicted 2027
2 SASI_Rn02_00381382 predicted 2037
3 SASI_Rn02_00381383 predicted 1960
4 SASI_Rn02_00381384 predicted 2024
5 SASI_Rn02_00381385 predicted 1924
6 SASI_Rn02_00381386 predicted 1274
7 SASI_Rn02_00381387 predicted 2036
8 SASI_Rn02_00381388 predicted 2045
9 SASI_Rn02_00381389 predicted 1877
10 SASI_Rn02_00381390 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037238 predicted 396
2 SASI_Mm02_00313451 predicted 257
3 SASI_Mm01_00037239 predicted 401
4 SASI_Mm02_00313452 predicted 358
5 SASI_Mm02_00313453 predicted 259
6 SASI_Mm02_00313454 predicted 358
7 SASI_Mm02_00313455 predicted 1204
8 SASI_Mm02_00313456 predicted 295
9 SASI_Mm02_00313457 predicted 1199
10 SASI_Mm01_00037233 predicted 1122
11 SASI_Mm01_00037234 predicted 1070
12 SASI_Mm01_00037235 predicted 1080
13 SASI_Mm01_00037236 predicted 1007
14 SASI_Mm01_00037237 predicted 1088
15 SASI_Mm01_00037240 predicted 1113
16 SASI_Mm01_00037241 predicted 1074
17 SASI_Mm01_00037242 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005342
VALIDATED
HMGB3 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-346s21c1
Sequence:CCGGAGAAGAAGAAGGATCCTAATGCTCGAGCATTAGGATCCTTCTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-777s21c1
Sequence:CCGGTGTTGCCCTCATTAGGTTTAACTCGAGTTAAACCTAATGAGGGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-185s21c1
Sequence:CCGGCCCAGAGGTCCCTGTCAATTTCTCGAGAAATTGACAGGGACCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-554s21c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-842s21c1
Sequence:CCGGCTAGAAATTGTCAGTGGTTTACTCGAGTAAACCACTGACAATTTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-736s1c1
Sequence:CCGGGCCGTAATTGACACATCTCTTCTCGAGAAGAGATGTGTCAATTACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-245s1c1
Sequence:CCGGCGGGAAAGAGAAATCCAAATTCTCGAGAATTTGGATTTCTCTTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005342.1-122s1c1
Sequence:CCGGGACGTCCGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCGGACGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-525s1c1
Sequence:CCGGGCAAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-282s1c1
Sequence:CCGGGCAGATAAAGTGCGCTATGATCTCGAGATCATAGCGCACTTTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-155s21c1
Sequence:CCGGGACATGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005342
VALIDATED
HMGB3 MISSION shRNA shRNA Plasmid DNA
high mobility group box 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-346s21c1
Sequence:CCGGAGAAGAAGAAGGATCCTAATGCTCGAGCATTAGGATCCTTCTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-777s21c1
Sequence:CCGGTGTTGCCCTCATTAGGTTTAACTCGAGTTAAACCTAATGAGGGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-185s21c1
Sequence:CCGGCCCAGAGGTCCCTGTCAATTTCTCGAGAAATTGACAGGGACCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-554s21c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-842s21c1
Sequence:CCGGCTAGAAATTGTCAGTGGTTTACTCGAGTAAACCACTGACAATTTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-736s1c1
Sequence:CCGGGCCGTAATTGACACATCTCTTCTCGAGAAGAGATGTGTCAATTACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-245s1c1
Sequence:CCGGCGGGAAAGAGAAATCCAAATTCTCGAGAATTTGGATTTCTCTTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005342.1-122s1c1
Sequence:CCGGGACGTCCGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCGGACGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-525s1c1
Sequence:CCGGGCAAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-282s1c1
Sequence:CCGGGCAGATAAAGTGCGCTATGATCTCGAGATCATAGCGCACTTTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-155s21c1
Sequence:CCGGGACATGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005342
VALIDATED
HMGB3 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-346s21c1
Sequence:CCGGAGAAGAAGAAGGATCCTAATGCTCGAGCATTAGGATCCTTCTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-777s21c1
Sequence:CCGGTGTTGCCCTCATTAGGTTTAACTCGAGTTAAACCTAATGAGGGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-185s21c1
Sequence:CCGGCCCAGAGGTCCCTGTCAATTTCTCGAGAAATTGACAGGGACCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-554s21c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005342.2-842s21c1
Sequence:CCGGCTAGAAATTGTCAGTGGTTTACTCGAGTAAACCACTGACAATTTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-736s1c1
Sequence:CCGGGCCGTAATTGACACATCTCTTCTCGAGAAGAGATGTGTCAATTACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-245s1c1
Sequence:CCGGCGGGAAAGAGAAATCCAAATTCTCGAGAATTTGGATTTCTCTTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005342.1-122s1c1
Sequence:CCGGGACGTCCGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCGGACGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-525s1c1
Sequence:CCGGGCAAAGCTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAGCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005342.1-282s1c1
Sequence:CCGGGCAGATAAAGTGCGCTATGATCTCGAGATCATAGCGCACTTTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005342.2-155s21c1
Sequence:CCGGGACATGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008253
HMGB3 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-360s21c1
Sequence:CCGGTCTAGCAAAGAGAAATCAAAGCTCGAGCTTTGATTTCTCTTTGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-881s21c1
Sequence:CCGGTATTGCCCTTGTTAGGTTTAACTCGAGTTAAACCTAACAAGGGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-672s21c1
Sequence:CCGGGTTGCTGACTATAAGTCTAAACTCGAGTTTAGACTTATAGTCAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-586s21c1
Sequence:CCGGGTGAGATGTGGAATAACTTAACTCGAGTTAAGTTATTCCACATCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-295s21c1
Sequence:CCGGACCCAGAGGTTCCCGTCAATTCTCGAGAATTGACGGGAACCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-397s21c1
Sequence:CCGGAGGCAGATAAAGTCCGATATGCTCGAGCATATCGGACTTTATCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-1124s21c1
Sequence:CCGGGTAAGGTAGTGTTAACTATATCTCGAGATATAGTTAACACTACCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-266s21c1
Sequence:CCGGGACATGCAGGGAAGAACATAACTCGAGTTATGTTCTTCCCTGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-410s1c1
Sequence:CCGGCCGATATGATCGGGAGATGAACTCGAGTTCATCTCCCGATCATATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-717s1c1
Sequence:CCGGCCTGCTAAAGTTGCCCGGAAACTCGAGTTTCCGGGCAACTTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-399s1c1
Sequence:CCGGGCAGATAAAGTCCGATATGATCTCGAGATCATATCGGACTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008253.2-980s1c1
Sequence:CCGGGCGCCCTGAAACTGTATCAAACTCGAGTTTGATACAGTTTCAGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-665s1c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008253
HMGB3 MISSION shRNA shRNA Plasmid DNA
high mobility group box 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-360s21c1
Sequence:CCGGTCTAGCAAAGAGAAATCAAAGCTCGAGCTTTGATTTCTCTTTGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-881s21c1
Sequence:CCGGTATTGCCCTTGTTAGGTTTAACTCGAGTTAAACCTAACAAGGGCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-672s21c1
Sequence:CCGGGTTGCTGACTATAAGTCTAAACTCGAGTTTAGACTTATAGTCAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-586s21c1
Sequence:CCGGGTGAGATGTGGAATAACTTAACTCGAGTTAAGTTATTCCACATCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-295s21c1
Sequence:CCGGACCCAGAGGTTCCCGTCAATTCTCGAGAATTGACGGGAACCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-397s21c1
Sequence:CCGGAGGCAGATAAAGTCCGATATGCTCGAGCATATCGGACTTTATCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-1124s21c1
Sequence:CCGGGTAAGGTAGTGTTAACTATATCTCGAGATATAGTTAACACTACCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-266s21c1
Sequence:CCGGGACATGCAGGGAAGAACATAACTCGAGTTATGTTCTTCCCTGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-410s1c1
Sequence:CCGGCCGATATGATCGGGAGATGAACTCGAGTTCATCTCCCGATCATATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-717s1c1
Sequence:CCGGCCTGCTAAAGTTGCCCGGAAACTCGAGTTTCCGGGCAACTTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-399s1c1
Sequence:CCGGGCAGATAAAGTCCGATATGATCTCGAGATCATATCGGACTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008253.2-980s1c1
Sequence:CCGGGCGCCCTGAAACTGTATCAAACTCGAGTTTGATACAGTTTCAGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-665s1c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008253
HMGB3 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-360s21c1
Sequence:CCGGTCTAGCAAAGAGAAATCAAAGCTCGAGCTTTGATTTCTCTTTGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-881s21c1
Sequence:CCGGTATTGCCCTTGTTAGGTTTAACTCGAGTTAAACCTAACAAGGGCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-672s21c1
Sequence:CCGGGTTGCTGACTATAAGTCTAAACTCGAGTTTAGACTTATAGTCAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-586s21c1
Sequence:CCGGGTGAGATGTGGAATAACTTAACTCGAGTTAAGTTATTCCACATCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-295s21c1
Sequence:CCGGACCCAGAGGTTCCCGTCAATTCTCGAGAATTGACGGGAACCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-397s21c1
Sequence:CCGGAGGCAGATAAAGTCCGATATGCTCGAGCATATCGGACTTTATCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008253.3-1124s21c1
Sequence:CCGGGTAAGGTAGTGTTAACTATATCTCGAGATATAGTTAACACTACCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008253.3-266s21c1
Sequence:CCGGGACATGCAGGGAAGAACATAACTCGAGTTATGTTCTTCCCTGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-410s1c1
Sequence:CCGGCCGATATGATCGGGAGATGAACTCGAGTTCATCTCCCGATCATATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-717s1c1
Sequence:CCGGCCTGCTAAAGTTGCCCGGAAACTCGAGTTTCCGGGCAACTTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-399s1c1
Sequence:CCGGGCAGATAAAGTCCGATATGATCTCGAGATCATATCGGACTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008253.2-980s1c1
Sequence:CCGGGCGCCCTGAAACTGTATCAAACTCGAGTTTGATACAGTTTCAGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008253.2-665s1c1
Sequence:CCGGGAAGGATGTTGCTGACTATAACTCGAGTTATAGTCAGCAACATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)