EMAIL THIS PAGE TO A FRIEND

HMGB3P1

high mobility group box 3 pseudogene 1

7 Gene Product Result for
Synonyms: HMG4L HMGB3L1 dJ18C9.3
Species: Human HMGB3P1(128872)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002165 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375410 predicted 554
2 SASI_Hs02_00375411 predicted 517
3 SASI_Hs02_00375412 predicted 790
4 SASI_Hs02_00375413 predicted 788
5 SASI_Hs02_00375414 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178467
HMGB3P1 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 3 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-180s1c1
Sequence:CCGGGCACTGTGATAGAGAAATGAACTCGAGTTCATTTCTCTATCACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-156s1c1
Sequence:CCGGTGGGAAAGAGAAGGCGGATAACTCGAGTTATCCGCCTTCTCTTTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-169s1c1
Sequence:CCGGGCGGATAAAGTGCACTGTGATCTCGAGATCACAGTGCACTTTATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-218s1c1
Sequence:CCGGAGGGAGGCAAGAACGATCCTACTCGAGTAGGATCGTTCTTGCCTCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-345s1c1
Sequence:CCGGGCTGGGTGAGATGTGGAATAACTCGAGTTATTCCACATCTCACCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178467
HMGB3P1 MISSION shRNA shRNA Plasmid DNA
high mobility group box 3 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-180s1c1
Sequence:CCGGGCACTGTGATAGAGAAATGAACTCGAGTTCATTTCTCTATCACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-156s1c1
Sequence:CCGGTGGGAAAGAGAAGGCGGATAACTCGAGTTATCCGCCTTCTCTTTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-169s1c1
Sequence:CCGGGCGGATAAAGTGCACTGTGATCTCGAGATCACAGTGCACTTTATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-218s1c1
Sequence:CCGGAGGGAGGCAAGAACGATCCTACTCGAGTAGGATCGTTCTTGCCTCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-345s1c1
Sequence:CCGGGCTGGGTGAGATGTGGAATAACTCGAGTTATTCCACATCTCACCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178467
HMGB3P1 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 3 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-180s1c1
Sequence:CCGGGCACTGTGATAGAGAAATGAACTCGAGTTCATTTCTCTATCACAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-156s1c1
Sequence:CCGGTGGGAAAGAGAAGGCGGATAACTCGAGTTATCCGCCTTCTCTTTCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-169s1c1
Sequence:CCGGGCGGATAAAGTGCACTGTGATCTCGAGATCACAGTGCACTTTATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-218s1c1
Sequence:CCGGAGGGAGGCAAGAACGATCCTACTCGAGTAGGATCGTTCTTGCCTCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178467.1-345s1c1
Sequence:CCGGGCTGGGTGAGATGTGGAATAACTCGAGTTATTCCACATCTCACCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)