EMAIL THIS PAGE TO A FRIEND

HMGB3P27

high mobility group box 3 pseudogene 27

28 Gene Product Result for
Species: Human HMGB3P27(441795)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_497547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715230 Rosetta Predictions human pricing
XM_001716947 Rosetta Predictions human pricing
XM_497547 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402307 predicted 205
2 SASI_Hs02_00402308 predicted 207
3 SASI_Hs02_00402309 predicted 206
4 SASI_Hs02_00402310 predicted 154
5 SASI_Hs02_00402311 predicted 490
6 SASI_Hs02_00402312 predicted 547
7 SASI_Hs02_00402313 predicted 483
8 SASI_Hs02_00402314 predicted 166
9 SASI_Hs02_00402315 predicted 138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414012 predicted 199
2 SASI_Hs02_00414013 predicted 202
3 SASI_Hs02_00414014 predicted 204
4 SASI_Hs02_00414015 predicted 147
5 SASI_Hs02_00414016 predicted 486
6 SASI_Hs02_00414017 predicted 546
7 SASI_Hs02_00414018 predicted 482
8 SASI_Hs02_00414019 predicted 163
9 SASI_Hs02_00414020 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269271 predicted 232
2 SASI_Hs01_00269272 predicted 236
3 SASI_Hs01_00269273 predicted 229
4 SASI_Hs02_00480098 predicted 10
5 SASI_Hs01_00269276 predicted 181
6 SASI_Hs01_00269277 predicted 517
7 SASI_Hs01_00269278 predicted 569
8 SASI_Hs01_00269279 predicted 511
9 SASI_Hs01_00269274 predicted 194
10 SASI_Hs01_00269275 predicted 164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497547
HMGB3P27 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 3 pseudogene 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-277s21c1
Sequence:CCGGGGCAAGAAGAAGGATCCTAATCTCGAGATTAGGATCCTTCTTCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-173s1c1
Sequence:CCGGCTAAATTCAATGAACTGGCAACTCGAGTTGCCAGTTCATTGAATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-68s1c1
Sequence:CCGGGCAGAGAAGAACATAAGAAGACTCGAGTCTTCTTATGTTCTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-211s21c1
Sequence:CCGGGAACTGGCAAAGGCGGATAAACTCGAGTTTATCCGCCTTTGCCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-90s21c1
Sequence:CCGGGACGTGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-457s1c1
Sequence:CCGGGAGAAGGATGTTGCTGTCTATCTCGAGATAGACAGCAACATCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-382s1c1
Sequence:CCGGGAGATGTGGAAGAACTTAAATCTCGAGATTTAAGTTCTTCCACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-36s1c1
Sequence:CCGGGATGTCTGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-408s21c1
Sequence:CCGGTGAGATGTGGAAGAACTTAAACTCGAGTTTAAGTTCTTCCACATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-242s21c1
Sequence:CCGGATCAGGAAATTAAGGATTATGCTCGAGCATAATCCTTAATTTCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497547
HMGB3P27 MISSION shRNA shRNA Plasmid DNA
high mobility group box 3 pseudogene 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-277s21c1
Sequence:CCGGGGCAAGAAGAAGGATCCTAATCTCGAGATTAGGATCCTTCTTCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-173s1c1
Sequence:CCGGCTAAATTCAATGAACTGGCAACTCGAGTTGCCAGTTCATTGAATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-68s1c1
Sequence:CCGGGCAGAGAAGAACATAAGAAGACTCGAGTCTTCTTATGTTCTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-211s21c1
Sequence:CCGGGAACTGGCAAAGGCGGATAAACTCGAGTTTATCCGCCTTTGCCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-90s21c1
Sequence:CCGGGACGTGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-457s1c1
Sequence:CCGGGAGAAGGATGTTGCTGTCTATCTCGAGATAGACAGCAACATCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-382s1c1
Sequence:CCGGGAGATGTGGAAGAACTTAAATCTCGAGATTTAAGTTCTTCCACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-36s1c1
Sequence:CCGGGATGTCTGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-408s21c1
Sequence:CCGGTGAGATGTGGAAGAACTTAAACTCGAGTTTAAGTTCTTCCACATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-242s21c1
Sequence:CCGGATCAGGAAATTAAGGATTATGCTCGAGCATAATCCTTAATTTCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497547
HMGB3P27 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 3 pseudogene 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-277s21c1
Sequence:CCGGGGCAAGAAGAAGGATCCTAATCTCGAGATTAGGATCCTTCTTCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-173s1c1
Sequence:CCGGCTAAATTCAATGAACTGGCAACTCGAGTTGCCAGTTCATTGAATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-68s1c1
Sequence:CCGGGCAGAGAAGAACATAAGAAGACTCGAGTCTTCTTATGTTCTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-211s21c1
Sequence:CCGGGAACTGGCAAAGGCGGATAAACTCGAGTTTATCCGCCTTTGCCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-90s21c1
Sequence:CCGGGACGTGCAGAGAAGAACATAACTCGAGTTATGTTCTTCTCTGCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-457s1c1
Sequence:CCGGGAGAAGGATGTTGCTGTCTATCTCGAGATAGACAGCAACATCCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-382s1c1
Sequence:CCGGGAGATGTGGAAGAACTTAAATCTCGAGATTTAAGTTCTTCCACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497547.1-36s1c1
Sequence:CCGGGATGTCTGCTTATGCCTTCTTCTCGAGAAGAAGGCATAAGCAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-408s21c1
Sequence:CCGGTGAGATGTGGAAGAACTTAAACTCGAGTTTAAGTTCTTCCACATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_497547.2-242s21c1
Sequence:CCGGATCAGGAAATTAAGGATTATGCTCGAGCATAATCCTTAATTTCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)