EMAIL THIS PAGE TO A FRIEND

HMGB4

high mobility group box 4

52 Gene Product Result for
Synonyms: dJ1007G16.5
UniProtKB ID: Q8WW32, B2R4X7, Q0QWA4
Gene ID:
Mouse(69317) high-mobility group box 4
Rat(685271) high-mobility group box 4
Thale Cress(816263) high mobility group B4 protein
dog(609219) high mobility group box 4
domestic cat(101083018) high mobility group box 4
cow(539195) high mobility group box 4
sheep(101106375) high mobility group box 4
naked mole-rat(101702418) high mobility group box 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008728 Rosetta Predictions human pricing
NM_145205 Rosetta Predictions human pricing
NM_001109463 Rosetta Predictions rat pricing
NM_027036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049994 predicted 359
2 SASI_Hs01_00049995 predicted 358
3 SASI_Hs01_00049996 predicted 399
4 SASI_Hs01_00049997 predicted 351
5 SASI_Hs01_00049998 predicted 389
6 SASI_Hs01_00049999 predicted 364
7 SASI_Hs01_00050000 predicted 393
8 SASI_Hs01_00050001 predicted 348
9 SASI_Hs01_00050002 predicted 406
10 SASI_Hs01_00050003 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054882 predicted 2032
2 SASI_Hs01_00054883 predicted 2027
3 SASI_Hs01_00054884 predicted 2056
4 SASI_Hs01_00054885 predicted 2013
5 SASI_Hs01_00054886 predicted 2053
6 SASI_Hs01_00054887 predicted 2029
7 SASI_Hs01_00054888 predicted 2053
8 SASI_Hs01_00054889 predicted 2016
9 SASI_Hs01_00054890 predicted 2072
10 SASI_Hs01_00054891 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248657 predicted 221
2 SASI_Rn02_00248658 predicted 380
3 SASI_Rn02_00248659 predicted 208
4 SASI_Rn02_00248660 predicted 290
5 SASI_Rn02_00248661 predicted 222
6 SASI_Rn02_00248662 predicted 234
7 SASI_Rn02_00248663 predicted 328
8 SASI_Rn02_00248664 predicted 206
9 SASI_Rn02_00248665 predicted 327
10 SASI_Rn02_00248666 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191601 predicted 237
2 SASI_Mm01_00191600 predicted 287
3 SASI_Mm01_00191602 predicted 213
4 SASI_Mm01_00191603 predicted 216
5 SASI_Mm01_00191604 predicted 221
6 SASI_Mm02_00331432 predicted 416
7 SASI_Mm01_00191605 predicted 209
8 SASI_Mm01_00191606 predicted 209
9 SASI_Mm01_00191607 predicted 261
10 SASI_Mm02_00331433 predicted 198
11 SASI_Mm01_00191608 predicted 312
12 SASI_Mm01_00191609 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145205
HMGB4 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2048s21c1
Sequence:CCGGTCTTCTGCCAAGACCACTATGCTCGAGCATAGTGGTCTTGGCAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2150s21c1
Sequence:CCGGACCTGGAGAAGCACCCTTATGCTCGAGCATAAGGGTGCTTCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-207s1c1
Sequence:CCGGCCAAGTACCTACGTTGGCTTTCTCGAGAAAGCCAACGTAGGTACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-144s1c1
Sequence:CCGGGCAAATGTCTCTTCTTACGTTCTCGAGAACGTAAGAAGAGACATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-262s1c1
Sequence:CCGGGATCCATCTCAAAGCATGAAACTCGAGTTTCATGCTTTGAGATGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145205
HMGB4 MISSION shRNA shRNA Plasmid DNA
high mobility group box 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2048s21c1
Sequence:CCGGTCTTCTGCCAAGACCACTATGCTCGAGCATAGTGGTCTTGGCAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2150s21c1
Sequence:CCGGACCTGGAGAAGCACCCTTATGCTCGAGCATAAGGGTGCTTCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-207s1c1
Sequence:CCGGCCAAGTACCTACGTTGGCTTTCTCGAGAAAGCCAACGTAGGTACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-144s1c1
Sequence:CCGGGCAAATGTCTCTTCTTACGTTCTCGAGAACGTAAGAAGAGACATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-262s1c1
Sequence:CCGGGATCCATCTCAAAGCATGAAACTCGAGTTTCATGCTTTGAGATGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145205
HMGB4 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2048s21c1
Sequence:CCGGTCTTCTGCCAAGACCACTATGCTCGAGCATAGTGGTCTTGGCAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145205.3-2150s21c1
Sequence:CCGGACCTGGAGAAGCACCCTTATGCTCGAGCATAAGGGTGCTTCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-207s1c1
Sequence:CCGGCCAAGTACCTACGTTGGCTTTCTCGAGAAAGCCAACGTAGGTACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-144s1c1
Sequence:CCGGGCAAATGTCTCTTCTTACGTTCTCGAGAACGTAAGAAGAGACATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145205.2-262s1c1
Sequence:CCGGGATCCATCTCAAAGCATGAAACTCGAGTTTCATGCTTTGAGATGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027036
HMGB4 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-516s1c1
Sequence:CCGGCCACAACTGACGAAGCAGAAACTCGAGTTTCTGCTTCGTCAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-157s1c1
Sequence:CCGGTGTGTCTTCTTACATCCATTTCTCGAGAAATGGATGTAAGAAGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-270s1c1
Sequence:CCGGGATCCATCTCAAAGCACGAAACTCGAGTTTCGTGCTTTGAGATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-215s1c1
Sequence:CCGGCCAAATACCTACCTTGGCTTTCTCGAGAAAGCCAAGGTAGGTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-360s1c1
Sequence:CCGGGCAAGAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027036
HMGB4 MISSION shRNA shRNA Plasmid DNA
high mobility group box 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-516s1c1
Sequence:CCGGCCACAACTGACGAAGCAGAAACTCGAGTTTCTGCTTCGTCAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-157s1c1
Sequence:CCGGTGTGTCTTCTTACATCCATTTCTCGAGAAATGGATGTAAGAAGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-270s1c1
Sequence:CCGGGATCCATCTCAAAGCACGAAACTCGAGTTTCGTGCTTTGAGATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-215s1c1
Sequence:CCGGCCAAATACCTACCTTGGCTTTCTCGAGAAAGCCAAGGTAGGTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-360s1c1
Sequence:CCGGGCAAGAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027036
HMGB4 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-516s1c1
Sequence:CCGGCCACAACTGACGAAGCAGAAACTCGAGTTTCTGCTTCGTCAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-157s1c1
Sequence:CCGGTGTGTCTTCTTACATCCATTTCTCGAGAAATGGATGTAAGAAGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-270s1c1
Sequence:CCGGGATCCATCTCAAAGCACGAAACTCGAGTTTCGTGCTTTGAGATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-215s1c1
Sequence:CCGGCCAAATACCTACCTTGGCTTTCTCGAGAAAGCCAAGGTAGGTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027036.1-360s1c1
Sequence:CCGGGCAAGAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)