EMAIL THIS PAGE TO A FRIEND

HMGCL

3-hydroxymethyl-3-methylglutaryl-CoA lyase

67 Gene Product Result for
Synonyms: HL
UniProtKB ID: P35914, B4DUP4, B7UCC6, D3Y5K7, Q6IBC0, Q96FP8
Gene ID:
Human(3155) Summary: The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(15356) 3-hydroxy-3-methylglutaryl-Coenzyme A lyase
Rat(79238) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
Zebrafish(394190) 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase (hydroxymethylglutaricaciduria)
chicken(396316) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
dog(478187) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
domestic cat(101099569) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
cow(317658) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
domestic guinea pig(100713291) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
naked mole-rat(101716848) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
sheep(101119699) 3-hydroxymethyl-3-methylglutaryl-CoA lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M2537 Mevastatin ≥95% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000191 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU050141 MISSION® esiRNA esiRNA targeting mouse Hmgcl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000191 Rosetta Predictions human pricing
NM_024386 Rosetta Predictions rat pricing
NM_008254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136570 predicted 910
2 SASI_Hs01_00136571 predicted 448
3 SASI_Hs01_00136572 predicted 309
4 SASI_Hs01_00136573 predicted 212
5 SASI_Hs01_00136574 predicted 948
6 SASI_Hs01_00136575 predicted 909
7 SASI_Hs01_00136578 predicted 602
8 SASI_Hs01_00136579 predicted 225
9 SASI_Hs02_00302042 predicted 1088
10 SASI_Hs02_00302043 predicted 856
11 SASI_Hs01_00136576 predicted 1100
12 SASI_Hs01_00136577 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065754 predicted 426
2 SASI_Rn01_00065755 predicted 1022
3 SASI_Rn01_00065756 predicted 333
4 SASI_Rn02_00263986 predicted 564
5 SASI_Rn01_00065758 predicted 1006
6 SASI_Rn01_00065759 predicted 1091
7 SASI_Rn01_00065760 predicted 373
8 SASI_Rn01_00065761 predicted 409
9 SASI_Rn01_00065762 predicted 444
10 SASI_Rn01_00065763 predicted 1064
11 SASI_Rn01_00065757 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142528 predicted 838
2 SASI_Mm01_00142529 predicted 727
3 SASI_Mm02_00313458 predicted 277
4 SASI_Mm02_00313459 predicted 241
5 SASI_Mm01_00142530 predicted 749
6 SASI_Mm01_00142531 predicted 941
7 SASI_Mm01_00142532 predicted 384
8 SASI_Mm01_00142533 predicted 1081
9 SASI_Mm02_00313460 predicted 998
10 SASI_Mm01_00142535 predicted 443
11 SASI_Mm01_00142534 predicted 649
12 SASI_Mm01_00142536 predicted 865
13 SASI_Mm01_00142537 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008254
VALIDATED
HMGCL MISSION shRNA Bacterial Glycerol Stock
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-1061s1c1
Sequence:CCGGGATTCCTGGATGAGGAGTATACTCGAGTATACTCCTCATCCAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-209s1c1
Sequence:CCGGCTGATCGACATCGTTTCCGAACTCGAGTTCGGAAACGATGTCGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-453s1c1
Sequence:CCGGACTGCTCTATAGAGGAGAGTTCTCGAGAACTCTCCTCTATAGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-883s1c1
Sequence:CCGGCATGCTGAATGGCTTAGGGATCTCGAGATCCCTAAGCCATTCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-352s1c1
Sequence:CCGGGACTCCAAACATGAAAGGCTTCTCGAGAAGCCTTTCATGTTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-603s21c1
Sequence:CCGGTGTACTCGATGGGCTGCTATGCTCGAGCATAGCAGCCCATCGAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-438s21c1
Sequence:CCGGAGAACGCGAACTGCTCTATAGCTCGAGCTATAGAGCAGTTCGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-940s21c1
Sequence:CCGGCTTCATCTGTCAAGCCCTTAACTCGAGTTAAGGGCTTGACAGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-285s21c1
Sequence:CCGGCTGACCACTCTGACGTCTTGACTCGAGTCAAGACGTCAGAGTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-315s21c1
Sequence:CCGGAGAAGTTTCCCGGCATCAACTCTCGAGAGTTGATGCCGGGAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-1105s21c1
Sequence:CCGGGGTCCCTGTCCCTGATGATAACTCGAGTTATCATCAGGGACAGGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008254
VALIDATED
HMGCL MISSION shRNA shRNA Plasmid DNA
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-1061s1c1
Sequence:CCGGGATTCCTGGATGAGGAGTATACTCGAGTATACTCCTCATCCAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-209s1c1
Sequence:CCGGCTGATCGACATCGTTTCCGAACTCGAGTTCGGAAACGATGTCGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-453s1c1
Sequence:CCGGACTGCTCTATAGAGGAGAGTTCTCGAGAACTCTCCTCTATAGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-883s1c1
Sequence:CCGGCATGCTGAATGGCTTAGGGATCTCGAGATCCCTAAGCCATTCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-352s1c1
Sequence:CCGGGACTCCAAACATGAAAGGCTTCTCGAGAAGCCTTTCATGTTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-603s21c1
Sequence:CCGGTGTACTCGATGGGCTGCTATGCTCGAGCATAGCAGCCCATCGAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-438s21c1
Sequence:CCGGAGAACGCGAACTGCTCTATAGCTCGAGCTATAGAGCAGTTCGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-940s21c1
Sequence:CCGGCTTCATCTGTCAAGCCCTTAACTCGAGTTAAGGGCTTGACAGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-285s21c1
Sequence:CCGGCTGACCACTCTGACGTCTTGACTCGAGTCAAGACGTCAGAGTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-315s21c1
Sequence:CCGGAGAAGTTTCCCGGCATCAACTCTCGAGAGTTGATGCCGGGAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-1105s21c1
Sequence:CCGGGGTCCCTGTCCCTGATGATAACTCGAGTTATCATCAGGGACAGGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008254
VALIDATED
HMGCL MISSION shRNA Lentiviral Transduction Particles
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-1061s1c1
Sequence:CCGGGATTCCTGGATGAGGAGTATACTCGAGTATACTCCTCATCCAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-209s1c1
Sequence:CCGGCTGATCGACATCGTTTCCGAACTCGAGTTCGGAAACGATGTCGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008254.1-453s1c1
Sequence:CCGGACTGCTCTATAGAGGAGAGTTCTCGAGAACTCTCCTCTATAGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-883s1c1
Sequence:CCGGCATGCTGAATGGCTTAGGGATCTCGAGATCCCTAAGCCATTCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008254.1-352s1c1
Sequence:CCGGGACTCCAAACATGAAAGGCTTCTCGAGAAGCCTTTCATGTTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-603s21c1
Sequence:CCGGTGTACTCGATGGGCTGCTATGCTCGAGCATAGCAGCCCATCGAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-438s21c1
Sequence:CCGGAGAACGCGAACTGCTCTATAGCTCGAGCTATAGAGCAGTTCGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-940s21c1
Sequence:CCGGCTTCATCTGTCAAGCCCTTAACTCGAGTTAAGGGCTTGACAGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-285s21c1
Sequence:CCGGCTGACCACTCTGACGTCTTGACTCGAGTCAAGACGTCAGAGTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-315s21c1
Sequence:CCGGAGAAGTTTCCCGGCATCAACTCTCGAGAGTTGATGCCGGGAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008254.2-1105s21c1
Sequence:CCGGGGTCCCTGTCCCTGATGATAACTCGAGTTATCATCAGGGACAGGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000191
HMGCL MISSION shRNA Bacterial Glycerol Stock
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-189s1c1
Sequence:CCGGCTGATAGACATGCTTTCTGAACTCGAGTTCAGAAAGCATGTCTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-587s1c1
Sequence:CCGGGTTCTACTCAATGGGCTGCTACTCGAGTAGCAGCCCATTGAGTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-918s1c1
Sequence:CCGGGCTGGAAACTTTATCTGTCAACTCGAGTTGACAGATAAAGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-81s1c1
Sequence:CCGGACCTCATCTATGGGCACTTTACTCGAGTAAAGTGCCCATAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-375s1c1
Sequence:CCGGGCCAAGGAAGTAGTCATCTTTCTCGAGAAAGATGACTACTTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-609s21c1
Sequence:GTACCGGACCAAGAAGTTCTACTCAATGCTCGAGCATTGAGTAGAACTTCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000191.2-1098s21c1
Sequence:CCGGGGAAATGAGAATAGGTTAAATCTCGAGATTTAACCTATTCTCATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-996s21c1
Sequence:CCGGGTGGCTCAGGCTACCTGTAAACTCGAGTTTACAGGTAGCCTGAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-511s21c1
Sequence:CCGGCAGCGCAGTCAGCCAATATTTCTCGAGAAATATTGGCTGACTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-445s21c1
Sequence:CCGGTCACCAAGAAGAACATCAATTCTCGAGAATTGATGTTCTTCTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000191
HMGCL MISSION shRNA shRNA Plasmid DNA
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-189s1c1
Sequence:CCGGCTGATAGACATGCTTTCTGAACTCGAGTTCAGAAAGCATGTCTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-587s1c1
Sequence:CCGGGTTCTACTCAATGGGCTGCTACTCGAGTAGCAGCCCATTGAGTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-918s1c1
Sequence:CCGGGCTGGAAACTTTATCTGTCAACTCGAGTTGACAGATAAAGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-81s1c1
Sequence:CCGGACCTCATCTATGGGCACTTTACTCGAGTAAAGTGCCCATAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-375s1c1
Sequence:CCGGGCCAAGGAAGTAGTCATCTTTCTCGAGAAAGATGACTACTTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-609s21c1
Sequence:GTACCGGACCAAGAAGTTCTACTCAATGCTCGAGCATTGAGTAGAACTTCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000191.2-1098s21c1
Sequence:CCGGGGAAATGAGAATAGGTTAAATCTCGAGATTTAACCTATTCTCATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-996s21c1
Sequence:CCGGGTGGCTCAGGCTACCTGTAAACTCGAGTTTACAGGTAGCCTGAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-511s21c1
Sequence:CCGGCAGCGCAGTCAGCCAATATTTCTCGAGAAATATTGGCTGACTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-445s21c1
Sequence:CCGGTCACCAAGAAGAACATCAATTCTCGAGAATTGATGTTCTTCTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000191
HMGCL MISSION shRNA Lentiviral Transduction Particles
3-hydroxymethyl-3-methylglutaryl-CoA lyase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-189s1c1
Sequence:CCGGCTGATAGACATGCTTTCTGAACTCGAGTTCAGAAAGCATGTCTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-587s1c1
Sequence:CCGGGTTCTACTCAATGGGCTGCTACTCGAGTAGCAGCCCATTGAGTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-918s1c1
Sequence:CCGGGCTGGAAACTTTATCTGTCAACTCGAGTTGACAGATAAAGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-81s1c1
Sequence:CCGGACCTCATCTATGGGCACTTTACTCGAGTAAAGTGCCCATAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000191.1-375s1c1
Sequence:CCGGGCCAAGGAAGTAGTCATCTTTCTCGAGAAAGATGACTACTTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-609s21c1
Sequence:GTACCGGACCAAGAAGTTCTACTCAATGCTCGAGCATTGAGTAGAACTTCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000191.2-1098s21c1
Sequence:CCGGGGAAATGAGAATAGGTTAAATCTCGAGATTTAACCTATTCTCATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-996s21c1
Sequence:CCGGGTGGCTCAGGCTACCTGTAAACTCGAGTTTACAGGTAGCCTGAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-511s21c1
Sequence:CCGGCAGCGCAGTCAGCCAATATTTCTCGAGAAATATTGGCTGACTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000191.2-445s21c1
Sequence:CCGGTCACCAAGAAGAACATCAATTCTCGAGAATTGATGTTCTTCTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)