EMAIL THIS PAGE TO A FRIEND

HMGCLL1

3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1

133 Gene Product Result for
Synonyms: bA418P12.1 er-cHL
UniProtKB ID: Q8TB92, B1AQ42, B3KNV0, B7Z1S7, F8W793, Q6ZSA9
Gene ID:
Mouse(208982) 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
Rat(367112) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
sheep(101113541) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
domestic guinea pig(100732790) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
naked mole-rat(101723463) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Zebrafish(571388) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
domestic cat(101088750) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
cow(535508) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
dog(481852) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
chicken(421886) 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042406 Rosetta Predictions human pricing
NM_019036 Rosetta Predictions human pricing
XM_001058331 Rosetta Predictions rat pricing
XM_345953 Rosetta Predictions rat pricing
NM_173731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309578 predicted 515
2 SASI_Hs02_00309579 predicted 727
3 SASI_Hs02_00309580 predicted 1182
4 SASI_Hs02_00309581 predicted 1247
5 SASI_Hs02_00309582 predicted 624
6 SASI_Hs02_00309583 predicted 502
7 SASI_Hs02_00309584 predicted 1161
8 SASI_Hs02_00309585 predicted 614
9 SASI_Hs02_00309586 predicted 1221
10 SASI_Hs02_00309587 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175008 predicted 605
2 SASI_Hs01_00175010 predicted 825
3 SASI_Hs02_00352594 predicted 1270
4 SASI_Hs02_00352595 predicted 1338
5 SASI_Hs01_00175014 predicted 716
6 SASI_Hs01_00175015 predicted 599
7 SASI_Hs02_00352596 predicted 1251
8 SASI_Hs02_00352597 predicted 695
9 SASI_Hs02_00352598 predicted 1307
10 SASI_Hs02_00352599 predicted 1110
11 SASI_Hs01_00175006 predicted 1054
12 SASI_Hs01_00175007 predicted 1104
13 SASI_Hs01_00175009 predicted 234
14 SASI_Hs01_00175011 predicted 483
15 SASI_Hs01_00175012 predicted 456
16 SASI_Hs01_00175013 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289338 predicted 685
2 SASI_Rn02_00289339 predicted 853
3 SASI_Rn02_00289340 predicted 1092
4 SASI_Rn02_00289341 predicted 725
5 SASI_Rn02_00289342 predicted 1364
6 SASI_Rn02_00289343 predicted 514
7 SASI_Rn02_00289344 predicted 708
8 SASI_Rn02_00289345 predicted 698
9 SASI_Rn02_00289346 predicted 385
10 SASI_Rn02_00289347 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398909 predicted 1097
2 SASI_Rn02_00398910 predicted 1412
3 SASI_Rn02_00398911 predicted 1279
4 SASI_Rn02_00398912 predicted 1540
5 SASI_Rn02_00398913 predicted 946
6 SASI_Rn02_00398914 predicted 1180
7 SASI_Rn02_00398915 predicted 1540
8 SASI_Rn02_00398916 predicted 1349
9 SASI_Rn02_00398917 predicted 903
10 SASI_Rn02_00398918 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078505 predicted 1098
2 SASI_Mm01_00078506 predicted 974
3 SASI_Mm01_00078507 predicted 771
4 SASI_Mm01_00078508 predicted 445
5 SASI_Mm02_00345373 predicted 1006
6 SASI_Mm01_00078509 predicted 902
7 SASI_Mm01_00078510 predicted 249
8 SASI_Mm01_00078511 predicted 416
9 SASI_Mm01_00078512 predicted 355
10 SASI_Mm01_00078513 predicted 712
11 SASI_Mm01_00078514 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019036
HMGCLL1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-577s1c1
Sequence:CCGGCCTGTCCTTACTCCTAATCTTCTCGAGAAGATTAGGAGTAAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-992s1c1
Sequence:CCGGGCAAATATCCTTACGGCCCTTCTCGAGAAGGGCCGTAAGGATATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-236s1c1
Sequence:CCGGCGCAGACTTCTCTTCTAACAACTCGAGTTGTTAGAAGAGAAGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-692s1c1
Sequence:CCGGCCATTGAAGAAAGTATGGGAACTCGAGTTCCCATACTTTCTTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-846s1c1
Sequence:CCGGCGGCATGGGTTGTTATGAGATCTCGAGATCTCATAACAACCCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019036.2-1267s21c1
Sequence:CCGGGCTTGACTTGAATGGATTTATCTCGAGATAAATCCATTCAAGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019036
HMGCLL1 MISSION shRNA shRNA Plasmid DNA
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-577s1c1
Sequence:CCGGCCTGTCCTTACTCCTAATCTTCTCGAGAAGATTAGGAGTAAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-992s1c1
Sequence:CCGGGCAAATATCCTTACGGCCCTTCTCGAGAAGGGCCGTAAGGATATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-236s1c1
Sequence:CCGGCGCAGACTTCTCTTCTAACAACTCGAGTTGTTAGAAGAGAAGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-692s1c1
Sequence:CCGGCCATTGAAGAAAGTATGGGAACTCGAGTTCCCATACTTTCTTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-846s1c1
Sequence:CCGGCGGCATGGGTTGTTATGAGATCTCGAGATCTCATAACAACCCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019036.2-1267s21c1
Sequence:CCGGGCTTGACTTGAATGGATTTATCTCGAGATAAATCCATTCAAGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019036
HMGCLL1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-577s1c1
Sequence:CCGGCCTGTCCTTACTCCTAATCTTCTCGAGAAGATTAGGAGTAAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-992s1c1
Sequence:CCGGGCAAATATCCTTACGGCCCTTCTCGAGAAGGGCCGTAAGGATATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-236s1c1
Sequence:CCGGCGCAGACTTCTCTTCTAACAACTCGAGTTGTTAGAAGAGAAGTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-692s1c1
Sequence:CCGGCCATTGAAGAAAGTATGGGAACTCGAGTTCCCATACTTTCTTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019036.1-846s1c1
Sequence:CCGGCGGCATGGGTTGTTATGAGATCTCGAGATCTCATAACAACCCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019036.2-1267s21c1
Sequence:CCGGGCTTGACTTGAATGGATTTATCTCGAGATAAATCCATTCAAGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173731
HMGCLL1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173731.1-1902s1c1
Sequence:CCGGCCCTAGTCTATTTCCATAATACTCGAGTATTATGGAAATAGACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-453s1c1
Sequence:CCGGCCTGTCCTTACACCTAATCTTCTCGAGAAGATTAGGTGTAAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-870s1c1
Sequence:CCGGGCAAATATCCTAACAGCTCTTCTCGAGAAGAGCTGTTAGGATATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-973s1c1
Sequence:CCGGCCACTGAGGATTTGATATATACTCGAGTATATATCAAATCCTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-261s1c1
Sequence:CCGGCCAAGGGATGGATTGCAGAATCTCGAGATTCTGCAATCCATCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173731
HMGCLL1 MISSION shRNA shRNA Plasmid DNA
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173731.1-1902s1c1
Sequence:CCGGCCCTAGTCTATTTCCATAATACTCGAGTATTATGGAAATAGACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-453s1c1
Sequence:CCGGCCTGTCCTTACACCTAATCTTCTCGAGAAGATTAGGTGTAAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-870s1c1
Sequence:CCGGGCAAATATCCTAACAGCTCTTCTCGAGAAGAGCTGTTAGGATATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-973s1c1
Sequence:CCGGCCACTGAGGATTTGATATATACTCGAGTATATATCAAATCCTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-261s1c1
Sequence:CCGGCCAAGGGATGGATTGCAGAATCTCGAGATTCTGCAATCCATCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173731
HMGCLL1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173731.1-1902s1c1
Sequence:CCGGCCCTAGTCTATTTCCATAATACTCGAGTATTATGGAAATAGACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-453s1c1
Sequence:CCGGCCTGTCCTTACACCTAATCTTCTCGAGAAGATTAGGTGTAAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-870s1c1
Sequence:CCGGGCAAATATCCTAACAGCTCTTCTCGAGAAGAGCTGTTAGGATATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-973s1c1
Sequence:CCGGCCACTGAGGATTTGATATATACTCGAGTATATATCAAATCCTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173731.1-261s1c1
Sequence:CCGGCCAAGGGATGGATTGCAGAATCTCGAGATTCTGCAATCCATCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)