EMAIL THIS PAGE TO A FRIEND

HMGCR

3-hydroxy-3-methylglutaryl-CoA reductase

156 Gene Product Result for
Synonyms: LDLCQ3
UniProtKB ID: P04035, B7Z3Y9, Q8N190
Gene ID:
Human(3156) Summary: HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(15357) 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Rat(25675) 3-hydroxy-3-methylglutaryl-CoA reductase
fruit fly(42803) HMG Coenzyme A reductase
chicken(395145) 3-hydroxy-3-methylglutaryl-CoA reductase
cow(407159) 3-hydroxy-3-methylglutaryl-CoA reductase
Horse(100065577) 3-hydroxy-3-methylglutaryl-CoA reductase
domestic cat(101098922) 3-hydroxy-3-methylglutaryl-CoA reductase
dog(479182) 3-hydroxy-3-methylglutaryl-CoA reductase
domestic guinea pig(100726509) 3-hydroxy-3-methylglutaryl-CoA reductase
naked mole-rat(101717005) 3-hydroxy-3-methylglutaryl-CoA reductase
sheep(101108919) 3-hydroxy-3-methylglutaryl-CoA reductase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301586 ANTI-HMGCR (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4200529 Anti-HMGCR (internal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat, mouse
western blot pricing
SAB4200528 Anti-HMGCR antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
HPA008338 Anti-HMGCR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4100361 Monoclonal Anti-HMGCR antibody produced in mouse clone HMGCR-B307, culture supernatant human
western blot pricing
SAB4100362 Monoclonal Anti-HMGCR antibody produced in mouse clone HMGCR-C307, culture supernatant human
western blot pricing
SAB4100363 Monoclonal Anti-HMGCR antibody produced in mouse clone HMGCR-D307, culture supernatant human
western blot pricing
AMAB90618 Monoclonal Anti-HMGCR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0259, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AMAB90619 Monoclonal Anti-HMGCR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0260, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000859 Rosetta Predictions human pricing
NM_013134 Rosetta Predictions rat pricing
NM_008255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014353 predicted 2731
2 SASI_Hs01_00014354 predicted 370
3 SASI_Hs01_00014355 predicted 655
4 SASI_Hs02_00303376 predicted 2377
5 SASI_Hs01_00014356 predicted 1285
6 SASI_Hs01_00014357 predicted 239
7 SASI_Hs01_00014358 predicted 888
8 SASI_Hs02_00303377 predicted 404
9 SASI_Hs01_00014361 predicted 2747
10 SASI_Hs01_00014362 predicted 1910
11 SASI_Hs01_00014359 predicted 2519
12 SASI_Hs01_00014360 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120672 predicted 2222
2 SASI_Rn01_00120673 predicted 2648
3 SASI_Rn02_00260931 predicted 392
4 SASI_Rn01_00120675 predicted 376
5 SASI_Rn01_00120676 predicted 814
6 SASI_Rn01_00120677 predicted 2397
7 SASI_Rn02_00260932 predicted 857
8 SASI_Rn01_00120678 predicted 2100
9 SASI_Rn01_00120679 predicted 2234
10 SASI_Rn01_00120681 predicted 1726
11 SASI_Rn01_00120674 predicted 800
12 SASI_Rn01_00120680 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168722 predicted 1567
2 SASI_Mm01_00168723 predicted 2503
3 SASI_Mm01_00168724 predicted 2853
4 SASI_Mm01_00168725 predicted 1949
5 SASI_Mm01_00168726 predicted 926
6 SASI_Mm01_00168727 predicted 964
7 SASI_Mm01_00168728 predicted 1291
8 SASI_Mm01_00168730 predicted 2328
9 SASI_Mm01_00168731 predicted 2471
10 SASI_Mm02_00313461 predicted 2884
11 SASI_Mm01_00168729 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000859
VALIDATED
HMGCR MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA reductase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000859.1-556s1c1
Sequence:CCGGCCCTCGATGCTCTTGTTGAATCTCGAGATTCAACAAGAGCATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-269s1c1
Sequence:CCGGCCTGTATATTTACTTCCAGTTCTCGAGAACTGGAAGTAAATATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-2229s1c1
Sequence:CCGGGCTATGATTGAGGTCAACATTCTCGAGAATGTTGACCTCAATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-1896s1c1
Sequence:CCGGGCAGTGATAAAGGAGGCATTTCTCGAGAAATGCCTCCTTTATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000859.1-2127s1c1
Sequence:CCGGCCTGCTGCTATAAATTGGATACTCGAGTATCCAATTTATAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2763s21c1
Sequence:CCGGCAACAGGTCGAAGATCAATTTCTCGAGAAATTGATCTTCGACCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1688s21c1
Sequence:CCGGACCTACCTTACAGGGATTATACTCGAGTATAATCCCTGTAAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1632s21c1
Sequence:CCGGGAGAATGTTATTGGATATATGCTCGAGCATATATCCAATAACATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2230s21c1
Sequence:CCGGCTATGATTGAGGTCAACATTACTCGAGTAATGTTGACCTCAATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2754s21c1
Sequence:CCGGGGTTCTAAAGGACTAACATAACTCGAGTTATGTTAGTCCTTTAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2092s21c1
Sequence:CCGGTAGCCGTTAGTGGTAACTATTCTCGAGAATAGTTACCACTAACGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1014s21c1
Sequence:CCGGCAAGTTATTACCCTAAGTTTACTCGAGTAAACTTAGGGTAATAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2067s21c1
Sequence:CCGGTATAGCTGGACGCAACCTTTACTCGAGTAAAGGTTGCGTCCAGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000859.2-3881s21c1
Sequence:CCGGATCAACTTGTGTACTGATAAACTCGAGTTTATCAGTACACAAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1563s21c1
Sequence:CCGGGTTAGTCAATGCTAAGCATATCTCGAGATATGCTTAGCATTGACTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000859
VALIDATED
HMGCR MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA reductase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000859.1-556s1c1
Sequence:CCGGCCCTCGATGCTCTTGTTGAATCTCGAGATTCAACAAGAGCATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-269s1c1
Sequence:CCGGCCTGTATATTTACTTCCAGTTCTCGAGAACTGGAAGTAAATATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-2229s1c1
Sequence:CCGGGCTATGATTGAGGTCAACATTCTCGAGAATGTTGACCTCAATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-1896s1c1
Sequence:CCGGGCAGTGATAAAGGAGGCATTTCTCGAGAAATGCCTCCTTTATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000859.1-2127s1c1
Sequence:CCGGCCTGCTGCTATAAATTGGATACTCGAGTATCCAATTTATAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2763s21c1
Sequence:CCGGCAACAGGTCGAAGATCAATTTCTCGAGAAATTGATCTTCGACCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1688s21c1
Sequence:CCGGACCTACCTTACAGGGATTATACTCGAGTATAATCCCTGTAAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1632s21c1
Sequence:CCGGGAGAATGTTATTGGATATATGCTCGAGCATATATCCAATAACATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2230s21c1
Sequence:CCGGCTATGATTGAGGTCAACATTACTCGAGTAATGTTGACCTCAATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2754s21c1
Sequence:CCGGGGTTCTAAAGGACTAACATAACTCGAGTTATGTTAGTCCTTTAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2092s21c1
Sequence:CCGGTAGCCGTTAGTGGTAACTATTCTCGAGAATAGTTACCACTAACGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1014s21c1
Sequence:CCGGCAAGTTATTACCCTAAGTTTACTCGAGTAAACTTAGGGTAATAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2067s21c1
Sequence:CCGGTATAGCTGGACGCAACCTTTACTCGAGTAAAGGTTGCGTCCAGCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000859.2-3881s21c1
Sequence:CCGGATCAACTTGTGTACTGATAAACTCGAGTTTATCAGTACACAAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1563s21c1
Sequence:CCGGGTTAGTCAATGCTAAGCATATCTCGAGATATGCTTAGCATTGACTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000859
VALIDATED
HMGCR MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA reductase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000859.1-556s1c1
Sequence:CCGGCCCTCGATGCTCTTGTTGAATCTCGAGATTCAACAAGAGCATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-269s1c1
Sequence:CCGGCCTGTATATTTACTTCCAGTTCTCGAGAACTGGAAGTAAATATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-2229s1c1
Sequence:CCGGGCTATGATTGAGGTCAACATTCTCGAGAATGTTGACCTCAATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000859.1-1896s1c1
Sequence:CCGGGCAGTGATAAAGGAGGCATTTCTCGAGAAATGCCTCCTTTATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000859.1-2127s1c1
Sequence:CCGGCCTGCTGCTATAAATTGGATACTCGAGTATCCAATTTATAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2763s21c1
Sequence:CCGGCAACAGGTCGAAGATCAATTTCTCGAGAAATTGATCTTCGACCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1688s21c1
Sequence:CCGGACCTACCTTACAGGGATTATACTCGAGTATAATCCCTGTAAGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1632s21c1
Sequence:CCGGGAGAATGTTATTGGATATATGCTCGAGCATATATCCAATAACATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2230s21c1
Sequence:CCGGCTATGATTGAGGTCAACATTACTCGAGTAATGTTGACCTCAATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2754s21c1
Sequence:CCGGGGTTCTAAAGGACTAACATAACTCGAGTTATGTTAGTCCTTTAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.1-2092s21c1
Sequence:CCGGTAGCCGTTAGTGGTAACTATTCTCGAGAATAGTTACCACTAACGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.1-1014s21c1
Sequence:CCGGCAAGTTATTACCCTAAGTTTACTCGAGTAAACTTAGGGTAATAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000859.2-2067s21c1
Sequence:CCGGTATAGCTGGACGCAACCTTTACTCGAGTAAAGGTTGCGTCCAGCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000859.2-3881s21c1
Sequence:CCGGATCAACTTGTGTACTGATAAACTCGAGTTTATCAGTACACAAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000859.2-1563s21c1
Sequence:CCGGGTTAGTCAATGCTAAGCATATCTCGAGATATGCTTAGCATTGACTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008255
HMGCR MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-274s1c1
Sequence:CCGGCGCCATCCTGTACATTTACTTCTCGAGAAGTAAATGTACAGGATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-815s1c1
Sequence:CCGGGTAACCCAAAGGGTCAAGATACTCGAGTATCTTGACCCTTTGGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-470s1c1
Sequence:CCGGGCGAGTGCATTAGCAAAGTTTCTCGAGAAACTTTGCTAATGCACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-1024s1c1
Sequence:CCGGGCAAGTGATTACCCTGAGTTTCTCGAGAAACTCAGGGTAATCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008255.1-3201s1c1
Sequence:CCGGGCCTACTTCTTCATGGAAGAACTCGAGTTCTTCCATGAAGAAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2575s1c1
Sequence:CCGGCCGAATTGTATGTGGCACTGTCTCGAGACAGTGCCACATACAATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2414s1c1
Sequence:CCGGCCCACAAATGAAGACTTATATCTCGAGATATAAGTCTTCATTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-943s1c1
Sequence:CCGGCGAAGATGTGTCCAAGAGAATCTCGAGATTCTCTTGGACACATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008255.2-3221s1c1
Sequence:CCGGGAACTTTGCAATCTAAGTTTACTCGAGTAAACTTAGATTGCAAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.2-1728s1c1
Sequence:CCGGGAGAATGTGATCGGATATATGCTCGAGCATATATCCGATCACATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008255
HMGCR MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-274s1c1
Sequence:CCGGCGCCATCCTGTACATTTACTTCTCGAGAAGTAAATGTACAGGATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-815s1c1
Sequence:CCGGGTAACCCAAAGGGTCAAGATACTCGAGTATCTTGACCCTTTGGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-470s1c1
Sequence:CCGGGCGAGTGCATTAGCAAAGTTTCTCGAGAAACTTTGCTAATGCACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-1024s1c1
Sequence:CCGGGCAAGTGATTACCCTGAGTTTCTCGAGAAACTCAGGGTAATCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008255.1-3201s1c1
Sequence:CCGGGCCTACTTCTTCATGGAAGAACTCGAGTTCTTCCATGAAGAAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2575s1c1
Sequence:CCGGCCGAATTGTATGTGGCACTGTCTCGAGACAGTGCCACATACAATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2414s1c1
Sequence:CCGGCCCACAAATGAAGACTTATATCTCGAGATATAAGTCTTCATTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-943s1c1
Sequence:CCGGCGAAGATGTGTCCAAGAGAATCTCGAGATTCTCTTGGACACATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008255.2-3221s1c1
Sequence:CCGGGAACTTTGCAATCTAAGTTTACTCGAGTAAACTTAGATTGCAAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.2-1728s1c1
Sequence:CCGGGAGAATGTGATCGGATATATGCTCGAGCATATATCCGATCACATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008255
HMGCR MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-274s1c1
Sequence:CCGGCGCCATCCTGTACATTTACTTCTCGAGAAGTAAATGTACAGGATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-815s1c1
Sequence:CCGGGTAACCCAAAGGGTCAAGATACTCGAGTATCTTGACCCTTTGGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-470s1c1
Sequence:CCGGGCGAGTGCATTAGCAAAGTTTCTCGAGAAACTTTGCTAATGCACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008255.1-1024s1c1
Sequence:CCGGGCAAGTGATTACCCTGAGTTTCTCGAGAAACTCAGGGTAATCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008255.1-3201s1c1
Sequence:CCGGGCCTACTTCTTCATGGAAGAACTCGAGTTCTTCCATGAAGAAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2575s1c1
Sequence:CCGGCCGAATTGTATGTGGCACTGTCTCGAGACAGTGCCACATACAATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-2414s1c1
Sequence:CCGGCCCACAAATGAAGACTTATATCTCGAGATATAAGTCTTCATTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.1-943s1c1
Sequence:CCGGCGAAGATGTGTCCAAGAGAATCTCGAGATTCTCTTGGACACATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008255.2-3221s1c1
Sequence:CCGGGAACTTTGCAATCTAAGTTTACTCGAGTAAACTTAGATTGCAAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008255.2-1728s1c1
Sequence:CCGGGAGAATGTGATCGGATATATGCTCGAGCATATATCCGATCACATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)